Morpholino
MO1-upf1
- ID
- ZDB-MRPHLNO-090714-1
- Name
- MO1-upf1
- Previous Names
-
- Upf1 StartSite (1)
- Target
- Sequence
-
5' - CGCCTCCACACTCATCTTTATATTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-upf1
No data available
Phenotype
Phenotype resulting from MO1-upf1
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-upf1
1 - 5 of 16 Show all
Citations
- Rahmati, M., Chebli, J., Banote, R.K., Roselli, S., Agholme, L., Zetterberg, H., Abramsson, A. (2024) Fine-tuning amyloid precursor protein expression through non-sense mediated mRNA decay. eNeuro. 11(6):
- Xie, A., Ma, Z., Wang, J., Zhang, Y., Chen, Y., Yang, C., Chen, J., Peng, J. (2023) Upf3a but not Upf1 mediates the genetic compensation response induced by leg1 deleterious mutations in an H3K4me3-independent manner. Cell discovery. 9:6363
- Ma, Z., Zhu, P., Shi, H., Guo, L., Zhang, Q., Chen, Y., Chen, S., Zhang, Z., Peng, J., Chen, J. (2019) PTC-bearing mRNA elicits a genetic compensation response via Upf3a and COMPASS components. Nature. 568(7751):259-263
- Lei, L., Yan, S.Y., Yang, R., Chen, J.Y., Li, Y., Bu, Y., Chang, N., Zhou, Q., Zhu, X., Li, C.Y., Xiong, J.W. (2017) Spliceosomal protein eftud2 mutation leads to p53-dependent apoptosis in zebrafish neural progenitors. Nucleic acids research. 45(6):3422-3436
- Longman, D., Hug, N., Keith, M., Anastasaki, C., Patton, E.E., Grimes, G., and Cáceres, J.F. (2013) DHX34 and NBAS form part of an autoregulatory NMD circuit that regulates endogenous RNA targets in human cells, zebrafish and Caenorhabditis elegans. Nucleic acids research. 41(17):8319-31
- Anastasaki, C., Longman, D., Capper, A., Patton, E.E., and Cáceres, J.F. (2011) Dhx34 and Nbas function in the NMD pathway and are required for embryonic development in zebrafish. Nucleic acids research. 39(9):3686-3694
- Wittkopp, N., Huntzinger, E., Weiler, C., Saulière, J., Schmidt, S., Sonawane, M., and Izaurralde, E. (2009) Nonsense-mediated mRNA decay effectors are essential for zebrafish embryonic development and survival. Molecular and cellular biology. 29(13):3517-3528
1 - 7 of 7
Show