Morpholino

MO2-camk2b2

ID
ZDB-MRPHLNO-090608-2
Name
MO2-camk2b2
Previous Names
  • Camk2b2 MO B (1)
Target
Sequence
5' - GCGTGCAGGTTGTGGTTGCCATGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-camk2b2
Expressed Gene Anatomy Figures
bmp4 Fig. 3 with image,  Fig. 6 with image from Rothschild et al., 2009
dand5 Fig. 5 with image from Francescatto et al., 2010
gata4 Fig. 6 with image from Rothschild et al., 2009
myl7 Fig. 3 with image,  Fig. 6 with image from Rothschild et al., 2009
nkx2.5 Fig. 6 with image from Rothschild et al., 2009
tbx5a Fig. 6 with image from Rothschild et al., 2009
tbxta Fig. 5 with image from Francescatto et al., 2010
Phenotype
Phenotype resulting from MO2-camk2b2
Phenotype Fish Figures
calmodulin-dependent protein kinase activity decreased rate, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
determination of digestive tract left/right asymmetry disrupted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
determination of left/right asymmetry in diencephalon disrupted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO2-camk2b2 Fig. 6 with image from Francescatto et al., 2010
determination of liver left/right asymmetry disrupted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
digestive system centered, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
digestive system inverted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
epithalamus aplastic, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
epithalamus inverted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
head decreased size, abnormal WT + MO2-camk2b2 Fig. 2 with image from Rothschild et al., 2009
heart edematous, abnormal WT + MO2-camk2b2 Fig. 2 with image,  Fig. 3 with image from Rothschild et al., 2009
heart contraction decreased rate, abnormal WT + MO2-camk2b2 Fig. 2 with image from Rothschild et al., 2009
heart jogging disrupted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
heart looping arrested, abnormal WT + MO2-camk2b2 Fig. 2 with image,  Fig. 3 with image from Rothschild et al., 2009
heart tube centered, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
heart tube inverted, abnormal WT + MO2-camk2b2 Fig. 3 with image from Francescatto et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO2-camk2b2 Fig. 5 with image from Francescatto et al., 2010
Kupffer's vesicle calcium- and calmodulin-dependent protein kinase complex mislocalised posteriorly, abnormal WT + MO2-camk2b2 Fig. 7 with image from Francescatto et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO2-camk2b2 Fig. 5 with image from Francescatto et al., 2010
Kupffer's vesicle cilium decreased length, abnormal WT + MO2-camk2b2 Fig. 5 with image from Francescatto et al., 2010
pectoral fin decreased length, abnormal WT + MO2-camk2b2 Fig. 3 with image from Rothschild et al., 2009
pectoral fin morphogenesis process quality, abnormal WT + MO2-camk2b2 Fig. 2 with image from Rothschild et al., 2009
somite malformed, abnormal WT + MO2-camk2b2 Fig. 2 with image from Rothschild et al., 2009
Phenotype of all Fish created by or utilizing MO2-camk2b2
Phenotype Fish Conditions Figures
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
somite malformed, abnormal WT + MO2-camk2b2 standard conditions Fig. 2 with image from Rothschild et al., 2009
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO2-camk2b2 standard conditions Fig. 6 with image from Francescatto et al., 2010
Kupffer's vesicle cilium decreased length, abnormal WT + MO2-camk2b2 standard conditions Fig. 5 with image from Francescatto et al., 2010
heart tube centered, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
heart edematous, abnormal WT + MO2-camk2b2 standard conditions Fig. 2 with image,  Fig. 3 with image from Rothschild et al., 2009
Kupffer's vesicle calcium- and calmodulin-dependent protein kinase complex mislocalised posteriorly, abnormal WT + MO2-camk2b2 standard conditions Fig. 7 with image from Francescatto et al., 2010
digestive system inverted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
calmodulin-dependent protein kinase activity decreased rate, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
heart tube inverted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
pectoral fin decreased length, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Rothschild et al., 2009
heart jogging disrupted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
determination of liver left/right asymmetry disrupted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO2-camk2b2 standard conditions Fig. 5 with image from Francescatto et al., 2010
determination of digestive tract left/right asymmetry disrupted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
heart looping arrested, abnormal WT + MO2-camk2b2 standard conditions Fig. 2 with image,  Fig. 3 with image from Rothschild et al., 2009
digestive system centered, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
epithalamus aplastic, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
epithalamus inverted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
determination of left/right asymmetry in diencephalon disrupted, abnormal WT + MO2-camk2b2 standard conditions Fig. 3 with image from Francescatto et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO2-camk2b2 standard conditions Fig. 5 with image from Francescatto et al., 2010
heart contraction decreased rate, abnormal WT + MO2-camk2b2 standard conditions Fig. 2 with image from Rothschild et al., 2009
pectoral fin morphogenesis process quality, abnormal WT + MO2-camk2b2 standard conditions Fig. 2 with image from Rothschild et al., 2009
head decreased size, abnormal WT + MO2-camk2b2 standard conditions Fig. 2 with image from Rothschild et al., 2009
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO2-camk2a + MO2-camk2b2 standard conditions Fig. 6 with image from Francescatto et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.