Morpholino
MO2-cmlc1
- ID
- ZDB-MRPHLNO-090527-1
- Name
- MO2-cmlc1
- Previous Names
-
- MO-cmlc-1
- Target
- Sequence
-
5' - TGCCATGATGCTGATGGGAAAAGGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cmlc1
No data available
Phenotype
Phenotype resulting from MO2-cmlc1
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO2-cmlc1
1 - 5 of 6 Show all
Citations
- Bührdel, J.B., Hirth, S., Keßler, M., Westphal, S., Forster, M., Manta, L., Wiche, G., Schoser, B., Schessl, J., Schröder, R., Clemen, C.S., Eichinger, L., Fürst, D.O., van der Ven, P.F., Rottbauer, W., Just, S. (2015) In vivo characterization of human myofibrillar myopathy genes in zebrafish. Biochemical and Biophysical Research Communications. 461(2):217-23
- Heckel, E., Boselli, F., Roth, S., Krudewig, A., Belting, H. G., Charvin, G., Vermot, J. (2015) Oscillatory Flow Modulates Mechanosensitive klf2a Expression through trpv4 and trpp2 during Heart Valve Development. Current biology : CB. 25(10):1354-1361
- Goetz, J.G., Steed, E., Ferreira, R.R., Roth, S., Ramspacher, C., Boselli, F., Charvin, G., Liebling, M., Wyart, C., Schwab, Y., Vermot, J. (2014) Endothelial cilia mediate low flow sensing during zebrafish vascular development. Cell Reports. 6:799-808
- Meder, B., Laufer, C., Hassel, D., Just, S., Marquart, S., Vogel, B., Hess, A., Fishman, M.C., Katus, H.A., and Rottbauer, W. (2009) A Single Serine in the Carboxyl Terminus of Cardiac Essential Myosin Light Chain-1 Controls Cardiomyocyte Contractility In Vivo. Circulation research. 104(5):650-659
1 - 4 of 4
Show