Morpholino

MO1-cald1b

ID
ZDB-MRPHLNO-090413-1
Name
MO1-cald1b
Previous Names
None
Target
Sequence
5' - AGTAAAGTCTCTTATTCTTCAACGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cald1b
No data available
Phenotype
Phenotype resulting from MO1-cald1b
Phenotype Fish Figures
angiogenesis disrupted, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
aortic arch morphology, abnormal WT + MO1-cald1b Fig. 5 from Zheng et al., 2009
atrioventricular valve aplastic, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
atrium elongated, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
atrium increased size, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
blood circulation decreased occurrence, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
blood circulation disrupted, abnormal WT + MO1-cald1b Fig. 2text only from Zheng et al., 2009
text only from Zheng et al., 2009
blood vessel endothelial cell migration disrupted, abnormal WT + MO1-cald1b Fig. 2 from Zheng et al., 2009
blood vessel morphogenesis disrupted, abnormal WT + MO1-cald1b Fig. 1Fig. 2Fig. 4Fig. 5 from Zheng et al., 2009
cardiac conduction system development disrupted, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
cardiac muscle cell decreased amount, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
cardiac muscle cell decreased size, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
cardiac muscle cell proliferation disrupted, abnormal WT + MO1-cald1b Fig. 1text only from Zheng et al., 2009
cardiac ventricle elongated, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
caudal vein plexus decreased size, abnormal WT + MO1-cald1b Fig. 2 from Zheng et al., 2009
cranial vasculature dilated, abnormal WT + MO1-cald1b Fig. 4 from Zheng et al., 2009
cranial vasculature morphology, abnormal WT + MO1-cald1b Fig. 4 from Zheng et al., 2009
dorsal aorta morphology, abnormal WT + MO1-cald1b Fig. 2 from Zheng et al., 2009
dorsal longitudinal anastomotic vessel aplastic, abnormal WT + MO1-cald1b Fig. 2 from Zheng et al., 2009
heart contractility, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
heart decreased functionality, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
heart morphology, abnormal WT + MO1-cald1b Fig. 1text only from Zheng et al., 2009
heart contraction decreased rate, abnormal WT + MO1-cald1b text only from Zheng et al., 2009
Fig. 1 from Zheng et al., 2009
heart contraction irregular rhythm, abnormal WT + MO1-cald1b text only from Zheng et al., 2009
Fig. 1 from Zheng et al., 2009
heart looping disrupted, abnormal WT + MO1-cald1b Fig. 1text only from Zheng et al., 2009
heart morphogenesis disrupted, abnormal WT + MO1-cald1b Fig. 1text only from Zheng et al., 2009
intersegmental vessel decreased amount, abnormal WT + MO1-cald1b Fig. 2 from Zheng et al., 2009
intersegmental vessel morphology, abnormal WT + MO1-cald1b Fig. 2 from Zheng et al., 2009
mandibular arch skeleton morphology, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
morphogenesis of an epithelial sheet disrupted, abnormal WT + MO1-cald1b Fig. 2 from Zheng et al., 2009
nucleate erythrocyte aggregated, abnormal WT + MO1-cald1b Fig. 2 from Zheng et al., 2009
nucleate erythrocyte decreased amount, abnormal WT + MO1-cald1b text only from Zheng et al., 2009
nucleate erythrocyte fluid flow rate, abnormal WT + MO1-cald1b Fig. 2 from Zheng et al., 2009
pericardium edematous, abnormal WT + MO1-cald1b Fig. 1text only from Zheng et al., 2009
posterior cardinal vein morphology, abnormal WT + MO1-cald1b Fig. 2 from Zheng et al., 2009
skeletal system morphogenesis disrupted, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
subintestinal vein decreased functionality, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
subintestinal vein morphology, abnormal WT + MO1-cald1b Fig. 2 from Zheng et al., 2009
subintestinal vein structure, abnormal WT + MO1-cald1b Fig. 1 from Zheng et al., 2009
trunk vasculature broken, abnormal WT + MO1-cald1b text only from Zheng et al., 2009
trunk vasculature morphology, abnormal WT + MO1-cald1b Fig. 1Fig. 2text only from Zheng et al., 2009
Phenotype of all Fish created by or utilizing MO1-cald1b
Phenotype Fish Conditions Figures
angiogenesis disrupted, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
skeletal system morphogenesis disrupted, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
cardiac ventricle elongated, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
heart morphogenesis disrupted, abnormal WT + MO1-cald1b standard conditions Fig. 1text only from Zheng et al., 2009
blood vessel morphogenesis disrupted, abnormal WT + MO1-cald1b standard conditions Fig. 1Fig. 2Fig. 4Fig. 5 from Zheng et al., 2009
trunk vasculature morphology, abnormal WT + MO1-cald1b standard conditions Fig. 1Fig. 2text only from Zheng et al., 2009
dorsal aorta morphology, abnormal WT + MO1-cald1b standard conditions Fig. 2 from Zheng et al., 2009
atrium elongated, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
subintestinal vein morphology, abnormal WT + MO1-cald1b standard conditions Fig. 2 from Zheng et al., 2009
blood vessel endothelial cell migration disrupted, abnormal WT + MO1-cald1b standard conditions Fig. 2 from Zheng et al., 2009
cranial vasculature dilated, abnormal WT + MO1-cald1b standard conditions Fig. 4 from Zheng et al., 2009
cardiac muscle cell proliferation disrupted, abnormal WT + MO1-cald1b standard conditions Fig. 1text only from Zheng et al., 2009
atrium increased size, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
blood circulation disrupted, abnormal WT + MO1-cald1b standard conditions Fig. 2text only from Zheng et al., 2009
text only from Zheng et al., 2009
trunk vasculature broken, abnormal WT + MO1-cald1b standard conditions text only from Zheng et al., 2009
morphogenesis of an epithelial sheet disrupted, abnormal WT + MO1-cald1b standard conditions Fig. 2 from Zheng et al., 2009
caudal vein plexus decreased size, abnormal WT + MO1-cald1b standard conditions Fig. 2 from Zheng et al., 2009
subintestinal vein structure, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
cardiac muscle cell decreased amount, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
heart decreased functionality, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
heart contractility, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
heart looping disrupted, abnormal WT + MO1-cald1b standard conditions Fig. 1text only from Zheng et al., 2009
blood circulation decreased occurrence, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
atrioventricular valve aplastic, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
dorsal longitudinal anastomotic vessel aplastic, abnormal WT + MO1-cald1b standard conditions Fig. 2 from Zheng et al., 2009
nucleate erythrocyte aggregated, abnormal WT + MO1-cald1b standard conditions Fig. 2 from Zheng et al., 2009
nucleate erythrocyte fluid flow rate, abnormal WT + MO1-cald1b standard conditions Fig. 2 from Zheng et al., 2009
pericardium edematous, abnormal WT + MO1-cald1b standard conditions Fig. 1text only from Zheng et al., 2009
cardiac muscle cell decreased size, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
cardiac conduction system development disrupted, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
nucleate erythrocyte decreased amount, abnormal WT + MO1-cald1b standard conditions text only from Zheng et al., 2009
posterior cardinal vein morphology, abnormal WT + MO1-cald1b standard conditions Fig. 2 from Zheng et al., 2009
heart morphology, abnormal WT + MO1-cald1b standard conditions Fig. 1text only from Zheng et al., 2009
heart contraction irregular rhythm, abnormal WT + MO1-cald1b standard conditions text only from Zheng et al., 2009
Fig. 1 from Zheng et al., 2009
subintestinal vein decreased functionality, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
intersegmental vessel decreased amount, abnormal WT + MO1-cald1b standard conditions Fig. 2 from Zheng et al., 2009
aortic arch morphology, abnormal WT + MO1-cald1b standard conditions Fig. 5 from Zheng et al., 2009
intersegmental vessel morphology, abnormal WT + MO1-cald1b standard conditions Fig. 2 from Zheng et al., 2009
mandibular arch skeleton morphology, abnormal WT + MO1-cald1b standard conditions Fig. 1 from Zheng et al., 2009
heart contraction decreased rate, abnormal WT + MO1-cald1b standard conditions text only from Zheng et al., 2009
Fig. 1 from Zheng et al., 2009
cranial vasculature morphology, abnormal WT + MO1-cald1b standard conditions Fig. 4 from Zheng et al., 2009
Citations