Morpholino
MO3-iqcb1
- ID
- ZDB-MRPHLNO-090324-1
- Name
- MO3-iqcb1
- Previous Names
- Target
- Sequence
-
5' - TCAAATCTGAATACCTGAGGAGGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-iqcb1
No data available
Phenotype
Phenotype resulting from MO3-iqcb1
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO3-iqcb1
1 - 5 of 7 Show all
Citations
- Yu, T., Matsuda, M. (2020) Epb41l5 interacts with IQCB1 and regulates ciliary function in zebrafish embryos. Journal of Cell Science. 133(12):
- Zhao, C., and Malicki, J. (2011) Nephrocystins and MKS proteins interact with IFT particle and facilitate transport of selected ciliary cargos. The EMBO journal. 30(13):2532-2544
- Gerner, M., Haribaskar, R., Pütz, M., Czerwitzki, J., Walz, G., and Schäfer, T. (2010) The retinitis pigmentosa GTPase regulator interacting protein 1 (RPGRIP1) links RPGR to the nephronophthisis protein network. Kidney International. 77(10):891-896
- Schäfer, T., Pütz, M., Lienkamp, S., Ganner, A., Bergbreiter, A., Ramachandran, H., Gieloff, V., Gerner, M., Mattonet, C., Czarnecki, P.G., Sayer, J.A., Otto, E.A., Hildebrandt, F., Kramer-Zucker, A., and Walz, G. (2008) Genetic and physical interaction between the NPHP5 and NPHP6 gene products. Human molecular genetics. 17(23):3655-3662
1 - 4 of 4
Show