Morpholino
MO3-cdx1b
- ID
- ZDB-MRPHLNO-090217-2
- Name
- MO3-cdx1b
- Previous Names
-
- atgMO (1)
- Target
- Sequence
-
5' - TCTAGGAGATAACTCACGTACATTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the ATG start site of cdx1b.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-cdx1b
No data available
Phenotype
Phenotype resulting from MO3-cdx1b
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO3-cdx1b
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| intestinal bulb morphology, abnormal | WT + MO3-cdx1b | standard conditions |
Fig. 5
from Flores et al., 2008 |
| digestive tract development disrupted, abnormal | WT + MO3-cdx1b | standard conditions |
Fig. 5
from Flores et al., 2008 |
1 - 2 of 2
Citations
- Gao, C., Huang, W., Gao, Y., Jan Lo, L., Luo, L., Huang, H., Chen, J., Peng, J. (2018) Zebrafish hhex-null mutant develops an intrahepatic intestinal tube due to de-repression of cdx1b and pdx1. Journal of molecular cell biology. 11(6):448-462
- Flores, M.V., Hall, C.J., Davidson, A.J., Singh, P.P., Mahagaonkar, A.A., Zon, L.I., Crosier, K.E., and Crosier, P.S. (2008) Intestinal Differentiation in Zebrafish Requires Cdx1b, a Functional Equivalent of Mammalian Cdx2. Gastroenterology. 135(5):1665-1675
1 - 2 of 2
Show