Morpholino

MO2-sec13

ID
ZDB-MRPHLNO-090206-4
Name
MO2-sec13
Previous Names
None
Target
Sequence
5' - TTTGCTTATATCCCTCAACAACCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sec13
No data available
Phenotype
Phenotype resulting from MO2-sec13
Phenotype Fish Figures
amacrine cell decreased amount, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
Bruch's membrane aplastic, abnormal WT + MO2-sec13 Fig. 5 with image from Schmidt et al., 2013
cartilage development disrupted, abnormal WT + MO2-sec13 Fig. S3 from Townley et al., 2008
cell population proliferation decreased rate, abnormal WT + MO2-sec13 Fig. 2 with image from Schmidt et al., 2013
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO2-sec13 Fig. 7Fig. S3 from Townley et al., 2008
eye decreased size, abnormal WT + MO2-sec13 Fig. 1 with image from Schmidt et al., 2013
Fig. 7Fig. S3 from Townley et al., 2008
eye cell apoptotic, abnormal WT + MO2-sec13 Fig. 2 with image from Schmidt et al., 2013
eye photoreceptor cell endoplasmic reticulum dilated, abnormal WT + MO2-sec13 Fig. 4 with image from Schmidt et al., 2013
fin kinked, abnormal WT + MO2-sec13 Fig. 2 with image from Schmidt et al., 2013
head decreased size, abnormal WT + MO2-sec13 Fig. 1 with image from Schmidt et al., 2013
Fig. 7Fig. S3 from Townley et al., 2008
Meckel's cartilage malformed, abnormal WT + MO2-sec13 Fig. 7Fig. S3 from Townley et al., 2008
Muller cell decreased amount, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
Muller cell disoriented, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
neurocranium malformed, abnormal WT + MO2-sec13 Fig. 7Fig. S3 from Townley et al., 2008
opsin transport disrupted, abnormal WT + MO2-sec13 Fig. 4 with image from Schmidt et al., 2013
pectoral fin kinked, abnormal WT + MO2-sec13 Fig. 7Fig. S3 from Townley et al., 2008
pectoral fin malformed, abnormal WT + MO2-sec13 Fig. S3 from Townley et al., 2008
photoreceptor cell morphology, abnormal WT + MO2-sec13 Fig. 4 with image from Schmidt et al., 2013
photoreceptor cell differentiation disrupted, abnormal WT + MO2-sec13 Fig. 1 with imageFig. 4 with image from Schmidt et al., 2013
photoreceptor outer segment layer absent, abnormal WT + MO2-sec13 Fig. 1 with image from Schmidt et al., 2013
retina decreased size, abnormal WT + MO2-sec13 Fig. 1 with image from Schmidt et al., 2013
retina disorganized, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
retina nucleus condensed, abnormal WT + MO2-sec13 Fig. 1 with image from Schmidt et al., 2013
retina layer formation disrupted, abnormal WT + MO2-sec13 Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 5 with image from Schmidt et al., 2013
retinal cone cell decreased amount, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
retinal ganglion cell decreased amount, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
retinal photoreceptor layer absent, abnormal WT + MO2-sec13 Fig. 1 with imageFig. 5 with image from Schmidt et al., 2013
retinal pigmented epithelium hypertrophic, abnormal WT + MO2-sec13 Fig. 1 with imageFig. 5 with image from Schmidt et al., 2013
retinal pigmented epithelium basement membrane aplastic, abnormal WT + MO2-sec13 Fig. 5 with image from Schmidt et al., 2013
retinal pigmented epithelium neuroepithelial cell disorganized, abnormal WT + MO2-sec13 Fig. 5 with image from Schmidt et al., 2013
retinal rod cell aplastic, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
Phenotype of all Fish created by or utilizing MO2-sec13
Phenotype Fish Conditions Figures
photoreceptor cell differentiation disrupted, abnormal WT + MO2-sec13 standard conditions Fig. 1 with imageFig. 4 with image from Schmidt et al., 2013
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO2-sec13 standard conditions Fig. 7Fig. S3 from Townley et al., 2008
Bruch's membrane aplastic, abnormal WT + MO2-sec13 standard conditions Fig. 5 with image from Schmidt et al., 2013
Meckel's cartilage malformed, abnormal WT + MO2-sec13 standard conditions Fig. 7Fig. S3 from Townley et al., 2008
Muller cell decreased amount, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
neurocranium malformed, abnormal WT + MO2-sec13 standard conditions Fig. 7Fig. S3 from Townley et al., 2008
retina nucleus condensed, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image from Schmidt et al., 2013
Muller cell disoriented, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
retinal ganglion cell decreased amount, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
eye decreased size, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image from Schmidt et al., 2013
Fig. 7Fig. S3 from Townley et al., 2008
pectoral fin kinked, abnormal WT + MO2-sec13 standard conditions Fig. 7Fig. S3 from Townley et al., 2008
retinal photoreceptor layer absent, abnormal WT + MO2-sec13 standard conditions Fig. 1 with imageFig. 5 with image from Schmidt et al., 2013
retinal pigmented epithelium hypertrophic, abnormal WT + MO2-sec13 standard conditions Fig. 1 with imageFig. 5 with image from Schmidt et al., 2013
retinal rod cell aplastic, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
head decreased size, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image from Schmidt et al., 2013
Fig. 7Fig. S3 from Townley et al., 2008
cartilage development disrupted, abnormal WT + MO2-sec13 standard conditions Fig. S3 from Townley et al., 2008
retina disorganized, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
eye photoreceptor cell endoplasmic reticulum dilated, abnormal WT + MO2-sec13 standard conditions Fig. 4 with image from Schmidt et al., 2013
cell population proliferation decreased rate, abnormal WT + MO2-sec13 standard conditions Fig. 2 with image from Schmidt et al., 2013
opsin transport disrupted, abnormal WT + MO2-sec13 standard conditions Fig. 4 with image from Schmidt et al., 2013
retinal pigmented epithelium basement membrane aplastic, abnormal WT + MO2-sec13 standard conditions Fig. 5 with image from Schmidt et al., 2013
amacrine cell decreased amount, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
retinal cone cell decreased amount, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
pectoral fin malformed, abnormal WT + MO2-sec13 standard conditions Fig. S3 from Townley et al., 2008
retina layer formation disrupted, abnormal WT + MO2-sec13 standard conditions Fig. 1 with imageFig. 3 with imageFig. 5 with image from Schmidt et al., 2013
retinal pigmented epithelium neuroepithelial cell disorganized, abnormal WT + MO2-sec13 standard conditions Fig. 5 with image from Schmidt et al., 2013
eye cell apoptotic, abnormal WT + MO2-sec13 standard conditions Fig. 2 with image from Schmidt et al., 2013
photoreceptor outer segment layer absent, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image from Schmidt et al., 2013
fin kinked, abnormal WT + MO2-sec13 standard conditions Fig. 2 with image from Schmidt et al., 2013
retina decreased size, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image from Schmidt et al., 2013
photoreceptor cell morphology, abnormal WT + MO2-sec13 standard conditions Fig. 4 with image from Schmidt et al., 2013
retina layer formation disrupted, abnormal WT + MO2-sec13 + MO4-tp53 standard conditions Fig. 2 with image from Schmidt et al., 2013
fin kinked, abnormal WT + MO2-sec13 + MO4-tp53 standard conditions Fig. 2 with image from Schmidt et al., 2013
Citations