Morpholino

MO2-chata

ID

ZDB-MRPHLNO-090126-2

Name

MO2-chata

Previous Names

None

Target

Sequence

5' - ATCATACACCTAACACAATGATCAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-chata

No data available

Phenotype

Phenotype resulting from MO2-chata

Phenotype	Fish	Figures
motor neuron axon decreased length, abnormal	WT + MO2-chata	Fig. 6 from Sun et al., 2015
myotome acetylcholine-gated channel complex increased area, abnormal	WT + MO2-chata	Fig. 7 from Sun et al., 2015
myotome acetylcholine-gated channel complex chrna1 expression increased distribution, abnormal	WT + MO2-chata	Fig. 7 from Sun et al., 2015
myotome neuromuscular junction of skeletal muscle fiber area, abnormal	WT + MO2-chata	Fig. 7 from Sun et al., 2015
myotome regulation of synaptic transmission, cholinergic decreased process quality, abnormal	WT + MO2-chata	Fig. 7 from Sun et al., 2015
regulation of synaptic transmission, cholinergic decreased process quality, abnormal	WT + MO2-chata	Fig. 7 from Sun et al., 2015
spinal cord motor neuron axon guidance decreased process quality, abnormal	WT + MO2-chata	Fig. 6 from Sun et al., 2015
startle response disrupted, abnormal	WT + MO2-chata	Fig. 2 from Wang et al., 2008
thigmotaxis decreased occurrence, abnormal	WT + MO2-chata	Fig. 7 , Fig. S7 from Sun et al., 2015

Phenotype of all Fish created by or utilizing MO2-chata

Phenotype	Fish	Conditions	Figures
startle response disrupted, abnormal	WT + MO2-chata	standard conditions	Fig. 2 from Wang et al., 2008
myotome acetylcholine-gated channel complex chrna1 expression increased distribution, abnormal	WT + MO2-chata	standard conditions	Fig. 7 from Sun et al., 2015
thigmotaxis decreased occurrence, abnormal	WT + MO2-chata	standard conditions	Fig. 7 , Fig. S7 from Sun et al., 2015
regulation of synaptic transmission, cholinergic decreased process quality, abnormal	WT + MO2-chata	standard conditions	Fig. 7 from Sun et al., 2015
myotome neuromuscular junction of skeletal muscle fiber area, abnormal	WT + MO2-chata	standard conditions	Fig. 7 from Sun et al., 2015
myotome regulation of synaptic transmission, cholinergic decreased process quality, abnormal	WT + MO2-chata	standard conditions	Fig. 7 from Sun et al., 2015
motor neuron axon decreased length, abnormal	WT + MO2-chata	standard conditions	Fig. 6 from Sun et al., 2015
spinal cord motor neuron axon guidance decreased process quality, abnormal	WT + MO2-chata	standard conditions	Fig. 6 from Sun et al., 2015
myotome acetylcholine-gated channel complex increased area, abnormal	WT + MO2-chata	standard conditions	Fig. 7 from Sun et al., 2015

Citations