Morpholino
MO1-mir126
- ID
- ZDB-MRPHLNO-090112-4
- Name
- MO1-mir126
- Previous Names
- Targets
- Sequence
-
5' - TGCATTATTACTCACGGTACGAGTTTGAGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir126
No data available
Phenotype
Phenotype resulting from MO1-mir126
No data available
Phenotype of all Fish created by or utilizing MO1-mir126
1 - 5 of 23 Show all
Citations
- Kontarakis, Z., Rossi, A., Ramas, S., Dellinger, M.T., Stainier, D.Y.R. (2018) Mir-126 is a conserved modulator of lymphatic development. Developmental Biology. 437(2):120-130
- Grabher, C., Payne, E.M., Johnston, A.B., Bolli, N., Lechman, E., Dick, J.E., Kanki, J.P., and Look, A.T. (2011) Zebrafish microRNA-126 determines hematopoietic cell fate through c-Myb. Leukemia. 25(3):506-514
- Nicoli, S., Standley, C., Walker, P., Hurlstone, A., Fogarty, K.E., and Lawson, N.D. (2010) MicroRNA-mediated integration of haemodynamics and Vegf signalling during angiogenesis. Nature. 464(7292):1196-1200
- Fish, J.E., Santoro, M.M., Morton, S.U., Yu, S., Yeh, R.F., Wythe, J.D., Ivey, K.N., Bruneau, B.G., Stainier, D.Y., and Srivastava, D. (2008) miR-126 regulates angiogenic signaling and vascular integrity. Developmental Cell. 15(2):272-284
1 - 4 of 4
Show