Morpholino

MO1-cdk5

ID
ZDB-MRPHLNO-090106-1
Name
MO1-cdk5
Previous Names
  • cdk5-SMO (1)
Target
Sequence
5' - AGTGGCGTCTCTGACCTCAGCAGAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splicing modification. Morpholino targets the exon3–intron3 boundary and results in a shorter mRNA.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdk5
No data available
Phenotype
Phenotype resulting from MO1-cdk5
Phenotype Fish Figures
cranial nerve II aplastic, abnormal AB + MO1-cdk5 Fig. 3 from Leung et al., 2008
eye decreased size, abnormal AB + MO1-cdk5 Fig. 3,  Fig. S2 from Leung et al., 2008
retina morphology, abnormal AB + MO1-cdk5 Fig. S2 from Leung et al., 2008
retina layer formation disrupted, abnormal AB + MO1-cdk5 Fig. 3 from Leung et al., 2008
retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-cdk5 Fig. 3,  Fig. S2 from Leung et al., 2008
retinal ganglion cell layer morphology, abnormal AB + MO1-cdk5 Fig. 3 from Leung et al., 2008
retinal inner nuclear layer morphology, abnormal AB + MO1-cdk5 Fig. 3 from Leung et al., 2008
retinal outer nuclear layer morphology, abnormal AB + MO1-cdk5 Fig. 3 from Leung et al., 2008
retinal outer plexiform layer morphology, abnormal AB + MO1-cdk5 Fig. 3 from Leung et al., 2008
Rohon-Beard neuron displaced to spinal cord axis, abnormal WT + MO1-cdk5 Fig. 3 with image from Tanaka et al., 2012
whole organism decreased size, abnormal AB + MO1-cdk5 Fig. S2 from Leung et al., 2008
Phenotype of all Fish created by or utilizing MO1-cdk5
Phenotype Fish Conditions Figures
retinal ganglion cell layer morphology, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
retina layer formation disrupted, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
retinal inner nuclear layer morphology, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
retinal outer plexiform layer morphology, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
eye decreased size, abnormal AB + MO1-cdk5 standard conditions Fig. 3,  Fig. S2 from Leung et al., 2008
retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-cdk5 standard conditions Fig. 3,  Fig. S2 from Leung et al., 2008
retina morphology, abnormal AB + MO1-cdk5 standard conditions Fig. S2 from Leung et al., 2008
whole organism decreased size, abnormal AB + MO1-cdk5 standard conditions Fig. S2 from Leung et al., 2008
retinal outer nuclear layer morphology, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
cranial nerve II aplastic, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
Rohon-Beard neuron displaced to spinal cord axis, abnormal WT + MO1-cdk5 standard conditions Fig. 3 with image from Tanaka et al., 2012
CaP motoneuron mislocalised, abnormal RW + MO1-cdk5 + MO1-dyrk2 standard conditions Fig. 3 from Morimura et al., 2013
Rohon-Beard neuron displaced to spinal cord axis, abnormal WT + MO1-cdk5 + MO1-dyrk2 standard conditions Fig. 3 with image,  Fig. 9 with image from Tanaka et al., 2012
neural crest cell displaced to spinal cord lateral margin, abnormal WT + MO1-cdk5 + MO1-dyrk2 standard conditions Fig. 10 with image from Tanaka et al., 2012
Rohon-Beard neuron displaced to spinal cord axis, abnormal rw011bTg + MO1-cdk5 + MO1-dyrk2 standard conditions Fig. 7 with image from Tanaka et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.