Morpholino
MO1-prickle2b
- ID
- ZDB-MRPHLNO-081220-4
- Name
- MO1-prickle2b
- Previous Names
- None
- Target
- Sequence
-
5' - GTCACCGTCTTCTCCATCTCCAGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prickle2b
No data available
Phenotype
Phenotype resulting from MO1-prickle2b
| Phenotype | Fish | Figures |
|---|---|---|
| cloaca development disrupted, abnormal | zf106Tg + MO1-prickle2b |
Fig. 4
from Burcklé et al., 2011 |
| pronephros cystic, abnormal | WT + MO1-prickle2b |
Fig. 4
from Burcklé et al., 2011 Fig. 1 
from Skouloudaki et al., 2009 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-prickle2b
1 - 5 of 6 Show all
Citations
- Burcklé, C., Gaudé, H.M., Vesque, C., Silbermann, F., Salomon, R., Jeanpierre, C., Antignac, C., Saunier, S., and Schneider-Maunoury, S. (2011) Control of the Wnt pathways by nephrocystin-4 is required for morphogenesis of the zebrafish pronephros. Human molecular genetics. 20(13):2611-27
- Skouloudaki, K., Puetz, M., Simons, M., Courbard, J.R., Boehlke, C., Hartleben, B., Engel, C., Moeller, M.J., Englert, C., Bollig, F., Schäfer, T., Ramachandran, H., Mlodzik, M., Huber, T.B., Kuehn, E.W., Kim, E., Kramer-Zucker, A., and Walz, G. (2009) Scribble participates in Hippo signaling and is required for normal zebrafish pronephros development. Proceedings of the National Academy of Sciences of the United States of America. 106(21):8579-8584
- Veeman, M.T., Slusarski, D.C., Kaykas, A., Louie, S.H., and Moon, R.T. (2003) Zebrafish prickle, a modulator of noncanonical wnt/fz signaling, regulates gastrulation movements. Current biology : CB. 13(8):680-685
1 - 3 of 3
Show