Morpholino

MO1-mmp2

ID

ZDB-MRPHLNO-081029-8

Name

MO1-mmp2

Previous Names

None

Target

mmp2 (1)

Sequence

5' - GTGGCGAACAGCCCTTTCAGACGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-mmp2

Expressed Gene	Anatomy	Figures
myb	hematopoietic system posterior region ventral wall of dorsal aorta hematopoietic multipotent progenitor cell	Fig. 2 , Fig. 5 from Theodore et al., 2017
runx1	ventral wall of dorsal aorta hematopoietic multipotent progenitor cell	Fig. 2 from Theodore et al., 2017

Phenotype

Phenotype resulting from MO1-mmp2

Phenotype	Fish	Figures
head morphology, abnormal	WT + MO1-mmp2	text only from Coyle et al., 2008
hematopoietic system posterior region myb expression decreased amount, abnormal	WT + MO1-mmp2	Fig. 5 from Theodore et al., 2017
mandibular arch skeleton morphology, abnormal	WT + MO1-mmp2	text only from Coyle et al., 2008
ventral wall of dorsal aorta myb expression increased amount, abnormal	WT + MO1-mmp2	Fig. 5 from Theodore et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression spatial pattern, abnormal	WT + MO1-mmp2	Fig. 2 from Theodore et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell GFP expression spatial pattern, abnormal	la116Tg + MO1-mmp2	Fig. 2 from Theodore et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression spatial pattern, abnormal	WT + MO1-mmp2	Fig. 2 from Theodore et al., 2017

Phenotype of all Fish created by or utilizing MO1-mmp2

Phenotype	Fish	Conditions	Figures
head morphology, abnormal	WT + MO1-mmp2	standard conditions	text only from Coyle et al., 2008
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression spatial pattern, abnormal	WT + MO1-mmp2	control	Fig. 2 from Theodore et al., 2017
ventral wall of dorsal aorta myb expression increased amount, abnormal	WT + MO1-mmp2	control	Fig. 5 from Theodore et al., 2017
hematopoietic system posterior region myb expression decreased amount, abnormal	WT + MO1-mmp2	control	Fig. 5 from Theodore et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression spatial pattern, abnormal	WT + MO1-mmp2	control	Fig. 2 from Theodore et al., 2017
mandibular arch skeleton morphology, abnormal	WT + MO1-mmp2	standard conditions	text only from Coyle et al., 2008
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell GFP expression spatial pattern, abnormal	la116Tg + MO1-mmp2	control	Fig. 2 from Theodore et al., 2017
convergent extension involved in gastrulation disrupted, abnormal	WT + MO1-mmp2 + MO1-mmp9	standard conditions	Fig. 3 from Coyle et al., 2008
whole organism posterior region has fewer parts of type hematopoietic multipotent progenitor cell, abnormal	pd27Tg; zf169Tg + MO1-mmp2	chemical treatment by environment: N(2)-([biphenyl]-4-ylsulfonyl)-N-hydroxy-N(2)-isopropoxy-D-valinamide	Fig. 5 from Theodore et al., 2017
whole organism anterior region has extra parts of type hematopoietic multipotent progenitor cell, abnormal	pd27Tg; zf169Tg + MO1-mmp2	chemical treatment by environment: N(2)-([biphenyl]-4-ylsulfonyl)-N-hydroxy-N(2)-isopropoxy-D-valinamide	Fig. 5 from Theodore et al., 2017
hematopoietic stem cell migration decreased occurrence, abnormal	pd27Tg; zf169Tg + MO1-mmp2	chemical treatment by environment: N(2)-([biphenyl]-4-ylsulfonyl)-N-hydroxy-N(2)-isopropoxy-D-valinamide	Fig. 5 from Theodore et al., 2017

Citations