Morpholino

MO1-arl6

ID

ZDB-MRPHLNO-081027-3

Name

MO1-arl6

Previous Names

bbs3_aug (1)

Target

arl6 (2)

Sequence

5' - AGCTTGTCAAAAAGCCCCATTTGCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-arl6

Expressed Gene	Anatomy	Figures
opn1mw1	photoreceptor outer segment layer retinal outer nuclear layer cell body	Fig. 4 from Pretorius et al., 2010

Phenotype

Phenotype resulting from MO1-arl6

Phenotype	Fish	Figures
determination of left/right symmetry disrupted, abnormal	WT + MO1-arl6	Fig. 1 from Tayeh et al., 2008
heart looping disrupted, abnormal	WT + MO1-arl6	Fig. 1 from Tayeh et al., 2008
Kupffer's vesicle aplastic, abnormal	WT + MO1-arl6	Fig. 1 from Tayeh et al., 2008
Kupffer's vesicle decreased size, abnormal	WT + MO1-arl6	Fig. 2 from Pretorius et al., 2010 Fig. 1 from Tayeh et al., 2008
melanosome transport decreased rate, abnormal	WT + MO1-arl6	Fig. 2 from Pretorius et al., 2010
visual behavior disrupted, abnormal	WT + MO1-arl6	Fig. 3 from Pretorius et al., 2010

Phenotype of all Fish created by or utilizing MO1-arl6

Phenotype	Fish	Conditions	Figures
melanosome transport delayed, abnormal	WT + MO1-arl6	chemical treatment: (R)-adrenaline	Fig. 1 from Tayeh et al., 2008
heart looping disrupted, abnormal	WT + MO1-arl6	standard conditions	Fig. 1 from Tayeh et al., 2008
visual behavior disrupted, abnormal	WT + MO1-arl6	standard conditions	Fig. 3 from Pretorius et al., 2010
melanosome transport decreased rate, abnormal	WT + MO1-arl6	standard conditions	Fig. 2 from Pretorius et al., 2010
Kupffer's vesicle decreased size, abnormal	WT + MO1-arl6	standard conditions	Fig. 2 from Pretorius et al., 2010 Fig. 1 from Tayeh et al., 2008
Kupffer's vesicle aplastic, abnormal	WT + MO1-arl6	standard conditions	Fig. 1 from Tayeh et al., 2008
determination of left/right symmetry disrupted, abnormal	WT + MO1-arl6	standard conditions	Fig. 1 from Tayeh et al., 2008
Kupffer's vesicle decreased size, abnormal	WT + MO1-arl6 + MO1-bbs2	standard conditions	Fig. 2 from Tayeh et al., 2008
melanosome transport delayed, abnormal	WT + MO1-arl6 + MO1-bbs2	chemical treatment: (R)-adrenaline	Fig. 2 from Tayeh et al., 2008
melanosome transport delayed, abnormal	WT + MO1-arl6 + MO1-bbs7	chemical treatment: (R)-adrenaline	Fig. 3 from Tayeh et al., 2008
Kupffer's vesicle decreased size, abnormal	WT + MO1-arl6 + MO1-bbs7	standard conditions	Fig. 3 from Tayeh et al., 2008
visual behavior disrupted, abnormal	WT + MO1-arl6 + MO1-crx	standard conditions	Fig. 3 from Pretorius et al., 2011
melanosome transport delayed, abnormal	WT + MO1-arl6 + MO1-crx	standard conditions	Fig. 2 from Pretorius et al., 2011
Kupffer's vesicle decreased size, abnormal	WT + MO1-arl6 + MO2-bbs1	standard conditions	Fig. 2 from Tayeh et al., 2008
scapulocoracoid increased thickness, abnormal	WT + MO1-arl6 + MO2-bbs1	standard conditions	text only from Tayeh et al., 2008
melanosome transport delayed, abnormal	WT + MO1-arl6 + MO2-bbs1	chemical treatment: (R)-adrenaline	Fig. 2 from Tayeh et al., 2008

Citations