Morpholino
MO1-casp3a
- ID
- ZDB-MRPHLNO-081016-1
- Name
- MO1-casp3a
- Previous Names
-
- caspase-MO (1)
- Target
- Sequence
-
5' - TTGCGTCCACACAGTCTCCGTTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-casp3a
No data available
Phenotype
Phenotype resulting from MO1-casp3a
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-casp3a
1 - 5 of 28 Show all
Citations
- Iyer, H., Shen, K., Meireles, A.M., Talbot, W.S. (2022) A lysosomal regulatory circuit essential for the development and function of microglia. Science advances. 8:eabp8321
- Villani, A., Benjaminsen, J., Moritz, C., Henke, K., Hartmann, J., Norlin, N., Richter, K., Schieber, N.L., Franke, T., Schwab, Y., Peri, F. (2019) Clearance by Microglia Depends on Packaging of Phagosomes into a Unique Cellular Compartment. Developmental Cell. 49(1):77-88.e7
- Casano, A.M., Albert, M., Peri, F. (2016) Developmental Apoptosis Mediates Entry and Positioning of Microglia in the Zebrafish Brain. Cell Reports. 16(4):897-906
- Campbell, D.S., and Okamoto, H. (2013) Local caspase activation interacts with Slit-Robo signaling to restrict axonal arborization. The Journal of cell biology. 203(4):657-672
- Yamashita, M., Mizusawa, N., Hojo, M., and Yabu, T. (2008) Extensive apoptosis and abnormal morphogenesis in pro-caspase-3 transgenic zebrafish during development. The Journal of experimental biology. 211(Pt 12):1874-1881
1 - 5 of 5
Show