Morpholino
MO2-pax6b
- ID
- ZDB-MRPHLNO-080925-4
- Name
- MO2-pax6b
- Previous Names
- None
- Target
- Sequence
-
5' - GCCTGAGCCCTTCCGAGCAAAACAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Sequence in publication contained a typo; this represents the corrected sequence.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pax6b
No data available
Phenotype
Phenotype resulting from MO2-pax6b
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO2-pax6b
1 - 5 of 8 Show all
Citations
- Bhatia, S., Bengani, H., Fish, M., Brown, A., Divizia, M.T., de Marco, R., Damante, G., Grainger, R., van Heyningen, V., Kleinjan, D.A. (2013) Disruption of autoregulatory feedback by a mutation in a remote, ultraconserved PAX6 enhancer causes aniridia. American journal of human genetics. 93:1126-34
- Royo, J.L., Bessa, J., Hidalgo, C., Fernández-Miñán, A., Tena, J.J., Roncero, Y., Gómez-Skarmeta, J.L., and Casares, F. (2012) Identification and Analysis of Conserved cis-Regulatory Regions of the MEIS1 Gene. PLoS One. 7(3):e33617
- Coutinho, P., Pavlou, S., Bhatia, S., Chalmers, K.J., Kleinjan, D.A., and Vanheyningen, V. (2011) Discovery and assessment of conserved Pax6 target genes and enhancers. Genome research. 21(8):1349-59
- Kleinjan, D.A., Bancewicz, R.M., Gautier, P., Dahm, R., Schonthaler, H.B., Damante, G., Seawright, A., Hever, A.M., Yeyati, P.L., van Heyningen, V., and Coutinho, P. (2008) Subfunctionalization of Duplicated Zebrafish pax6 Genes by cis-Regulatory Divergence. PLoS Genetics. 4(2):e29
1 - 4 of 4
Show