Morpholino

MO2-chek1

ID
ZDB-MRPHLNO-080804-1
Name
MO2-chek1
Previous Names
None
Target
Sequence
5' - AGGCACAGCCATTATGCAATCTTCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-chek1
No data available
Phenotype
Phenotype resulting from MO2-chek1
Phenotype of all Fish created by or utilizing MO2-chek1
Phenotype Fish Conditions Figures
whole organism apoptotic, abnormal WT + MO2-chek1 radiation Fig. 2 with imageFig. 3 with image from Sidi et al., 2008
swim bladder decreased size, abnormal WT + MO2-chek1 standard conditions Fig. 2 with image from Sidi et al., 2008
mitotic G2 DNA damage checkpoint signaling disrupted, abnormal WT + MO2-chek1 radiation Fig. S1 with image from Sidi et al., 2008
protein phosphorylation disrupted, abnormal WT + MO2-chek1 standard conditions Fig. 2 with image from Sidi et al., 2008
embryo development delayed, abnormal WT + MO2-chek1 standard conditions Fig. 2 with image from Sidi et al., 2008
whole organism apoptotic, abnormal tp53zdf1/zdf1 + MO2-chek1 radiation Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. S4 with image from Sidi et al., 2008
myeloid cell decreased amount, abnormal tp53zdf1/zdf1 + MO2-chek1 radiation Fig. 2 with image from Sidi et al., 2008
mitotic G2 DNA damage checkpoint signaling disrupted, abnormal tp53zdf1/zdf1 + MO2-chek1 radiation Fig. S1 with image from Sidi et al., 2008
whole organism apoptotic, abnormal tp53zdf1/zdf1 + MO2-chek1 + MO4-tp53 radiation Fig. 2 with image from Sidi et al., 2008
whole organism apoptotic, abnormal tp53zdf2/zdf2 + MO2-chek1 radiation, heat shock Fig. 2 with image from Sidi et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO1-atm + MO2-chek1 radiation Fig. 4 with image from Sidi et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO1-atr + MO2-chek1 radiation Fig. 4 with image from Sidi et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO1-casp2 + MO2-chek1 radiation Fig. 4 with image from Sidi et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO1-casp9 + MO2-chek1 radiation Fig. 4 with image from Sidi et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO1-tp73 + MO2-chek1 radiation Fig. 4 with image from Sidi et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO2-bbc3 + MO2-chek1 radiation Fig. 4 with image from Sidi et al., 2008
whole organism apoptotic, abnormal tp53zdf1/zdf1 + MO2-chek1 + MO2-chek2 radiation Fig. S4 with image from Sidi et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO2-chek1 + MO3-tp63 radiation Fig. 4 with image from Sidi et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO1-tp73 + MO2-chek1 + MO3-tp63 radiation Fig. 4 with image from Sidi et al., 2008
Citations