Morpholino
MO2-fermt2
- ID
- ZDB-MRPHLNO-080708-2
- Name
- MO2-fermt2
- Previous Names
- None
- Target
- Sequence
-
5' - TACACCACCTCTGTCTAAACTCACC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a splice blocking morpholino that targets fermt2.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fermt2
No data available
Phenotype
Phenotype resulting from MO2-fermt2
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO2-fermt2
1 - 5 of 14 Show all
Citations
- Fitzpatrick, P., Shattil, S.J., Ablooglu, A.J. (2014) C-terminal COOH of Integrin beta1 Is Necessary for beta1 Association with the Kindlin-2 Adapter Protein. The Journal of biological chemistry. 289:11183-93
- Pluskota, E., Dowling, J.J., Gordon, N., Golden, J.A., Szpak, D., West, X.Z., Nestor, C., Ma, Y.Q., Bialkowska, K., Byzova, T., and Plow, E.F. (2011) The integrin co-activator Kindlin-2 plays a critical role in angiogenesis in mice and zebrafish. Blood. 117(18):4978-4987
- Dowling, J.J., Gibbs, E., Russell, M., Goldman, D., Minarcik, J., Golden, J.A., and Feldman, E.L. (2008) Kindlin-2 Is an Essential Component of Intercalated Discs and Is Required for Vertebrate Cardiac Structure and Function. Circulation research. 102(4):423-431
1 - 3 of 3
Show