Morpholino

MO1-fermt2

ID
ZDB-MRPHLNO-080708-1
Name
MO1-fermt2
Previous Names
None
Target
Sequence
5' - GCATCCGTATACCGTCCAGCGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino that targets fermt2.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fermt2
Expressed Gene Anatomy Figures
alcama Fig. 6 from Dowling et al., 2008
fermt2 Fig. 3 from Dowling et al., 2008
myl7 Fig. 6 from Dowling et al., 2008
prkcz Fig. 3 from Fitzpatrick et al., 2014
Phenotype
Phenotype resulting from MO1-fermt2
Phenotype Fish Figures
atrium dilated, abnormal WT + MO1-fermt2 Fig. 6 from Dowling et al., 2008
cardiac muscle cell intercalated disc decreased amount, abnormal WT + MO1-fermt2 Fig. 7 from Dowling et al., 2008
cardiac muscle cell intercalated disc decreased thickness, abnormal WT + MO1-fermt2 Fig. 7 from Dowling et al., 2008
cardiac muscle cell sarcomere mislocalised, abnormal WT + MO1-fermt2 Fig. 7 from Dowling et al., 2008
cardiac ventricle decreased contractility, abnormal WT + MO1-fermt2 Fig. 5 from Dowling et al., 2008
cardiac ventricle decreased size, abnormal WT + MO1-fermt2 Fig. 5,  Fig. 6 from Dowling et al., 2008
cardiac ventricle dilated, abnormal WT + MO1-fermt2 Fig. 6 from Dowling et al., 2008
central nervous system morphology, abnormal WT + MO1-fermt2 Fig. 3,  Fig. 4 from Dowling et al., 2008
eye morphology, abnormal WT + MO1-fermt2 Fig. 3,  Fig. 4 from Dowling et al., 2008
forerunner cell group disorganized, abnormal ha01Tg + MO1-fermt2 Fig. 3 from Fitzpatrick et al., 2014
heart morphology, abnormal WT + MO1-fermt2 Fig. 6 from Dowling et al., 2008
heart contraction decreased rate, abnormal WT + MO1-fermt2 Fig. 5 from Dowling et al., 2008
heart looping disrupted, abnormal WT + MO1-fermt2 Fig. 6 from Dowling et al., 2008
Kupffer's vesicle malformed, abnormal ha01Tg + MO1-fermt2 Fig. 3 from Fitzpatrick et al., 2014
pericardium edematous, abnormal WT + MO1-fermt2 Fig. 3,  Fig. 4,  Fig. 6 from Dowling et al., 2008
post-vent region decreased length, abnormal WT + MO1-fermt2 Fig. 3,  Fig. 4 from Dowling et al., 2008
skeletal muscle cell vacuolated, abnormal WT + MO1-fermt2 Fig. 8 from Dowling et al., 2008
skeletal muscle cell myofibril disorganized, abnormal WT + MO1-fermt2 Fig. 8 from Dowling et al., 2008
trunk bent, abnormal WT + MO1-fermt2 Fig. 3,  Fig. 4 from Dowling et al., 2008
whole organism decreased size, abnormal WT + MO1-fermt2 Fig. 3,  Fig. 4 from Dowling et al., 2008
whole organism paralysed, abnormal WT + MO1-fermt2 text only from Dowling et al., 2008
Phenotype of all Fish created by or utilizing MO1-fermt2
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO1-fermt2 standard conditions Fig. 3,  Fig. 4,  Fig. 6 from Dowling et al., 2008
skeletal muscle cell myofibril disorganized, abnormal WT + MO1-fermt2 standard conditions Fig. 8 from Dowling et al., 2008
cardiac ventricle decreased size, abnormal WT + MO1-fermt2 standard conditions Fig. 5,  Fig. 6 from Dowling et al., 2008
eye morphology, abnormal WT + MO1-fermt2 standard conditions Fig. 3,  Fig. 4 from Dowling et al., 2008
heart looping disrupted, abnormal WT + MO1-fermt2 standard conditions Fig. 6 from Dowling et al., 2008
skeletal muscle cell vacuolated, abnormal WT + MO1-fermt2 standard conditions Fig. 8 from Dowling et al., 2008
cardiac muscle cell intercalated disc decreased thickness, abnormal WT + MO1-fermt2 standard conditions Fig. 7 from Dowling et al., 2008
heart contraction decreased rate, abnormal WT + MO1-fermt2 standard conditions Fig. 5 from Dowling et al., 2008
atrium dilated, abnormal WT + MO1-fermt2 standard conditions Fig. 6 from Dowling et al., 2008
central nervous system morphology, abnormal WT + MO1-fermt2 standard conditions Fig. 3,  Fig. 4 from Dowling et al., 2008
post-vent region decreased length, abnormal WT + MO1-fermt2 standard conditions Fig. 3,  Fig. 4 from Dowling et al., 2008
cardiac ventricle decreased contractility, abnormal WT + MO1-fermt2 standard conditions Fig. 5 from Dowling et al., 2008
cardiac ventricle dilated, abnormal WT + MO1-fermt2 standard conditions Fig. 6 from Dowling et al., 2008
whole organism decreased size, abnormal WT + MO1-fermt2 standard conditions Fig. 3,  Fig. 4 from Dowling et al., 2008
heart morphology, abnormal WT + MO1-fermt2 standard conditions Fig. 6 from Dowling et al., 2008
whole organism paralysed, abnormal WT + MO1-fermt2 standard conditions text only from Dowling et al., 2008
cardiac muscle cell intercalated disc decreased amount, abnormal WT + MO1-fermt2 standard conditions Fig. 7 from Dowling et al., 2008
cardiac muscle cell sarcomere mislocalised, abnormal WT + MO1-fermt2 standard conditions Fig. 7 from Dowling et al., 2008
trunk bent, abnormal WT + MO1-fermt2 standard conditions Fig. 3,  Fig. 4 from Dowling et al., 2008
Kupffer's vesicle malformed, abnormal ha01Tg + MO1-fermt2 standard conditions Fig. 3 from Fitzpatrick et al., 2014
forerunner cell group disorganized, abnormal ha01Tg + MO1-fermt2 standard conditions Fig. 3 from Fitzpatrick et al., 2014
dorsal longitudinal anastomotic vessel morphology, abnormal s843Tg + MO1-fermt2 + MO2-fermt2 standard conditions Fig. 4 from Pluskota et al., 2011
intersegmental vessel decreased length, abnormal s843Tg + MO1-fermt2 + MO2-fermt2 standard conditions Fig. 4 from Pluskota et al., 2011
intersegmental vessel decreased thickness, abnormal s843Tg + MO1-fermt2 + MO2-fermt2 standard conditions Fig. 4 from Pluskota et al., 2011
angiogenesis disrupted, abnormal s843Tg + MO1-fermt2 + MO2-fermt2 standard conditions Fig. 4 from Pluskota et al., 2011
trunk vasculature malformed, abnormal s843Tg + MO1-fermt2 + MO2-fermt2 standard conditions Fig. 4 from Pluskota et al., 2011
forerunner cell group disorganized, abnormal ha01Tg + MO1-fermt2 + MO1-itgav standard conditions Fig. 3 from Fitzpatrick et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.