Morpholino
MO1-gli2b
- ID
- ZDB-MRPHLNO-080703-4
- Name
- MO1-gli2b
- Previous Names
-
- gli2bATG (1)
- Target
- Sequence
-
5' - CGGGAGCTGGAACACCGGCCTCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino that targets gli2b.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gli2b
No data available
Phenotype
Phenotype resulting from MO1-gli2b
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-gli2b
1 - 5 of 17 Show all
Citations
- Maurya, A.K., Ben, J., Zhao, Z., Lee, R.T., Niah, W., Ng, A.S., Iyu, A., Yu, W., Elworthy, S., van Eeden, F.J., and Ingham, P.W. (2013) Positive and negative regulation of Gli activity by Kif7 in the zebrafish embryo. PLoS Genetics. 9(12):e1003955
- Reimer, M.M., Norris, A., Ohnmacht, J., Patani, R., Zhong, Z., Dias, T.B., Kuscha, V., Scott, A.L., Chen, Y.C., Rozov, S., Frazer, S.L., Wyatt, C., Higashijima, S., Patton, E.E., Panula, P., Chandran, S., Becker, T., and Becker, C.G. (2013) Dopamine from the Brain Promotes Spinal Motor Neuron Generation during Development and Adult Regeneration. Developmental Cell. 25(5):478-491
- Huang, P., and Schier, A.F. (2009) Dampened Hedgehog signaling but normal Wnt signaling in zebrafish without cilia. Development (Cambridge, England). 136(18):3089-3098
- Ke, Z., Kondrichin, I., Gong, Z., and Korzh, V. (2008) Combined activity of the two Gli2 genes of zebrafish play a major role in Hedgehog signaling during zebrafish neurodevelopment. Molecular and cellular neurosciences. 37(2):388-401
1 - 4 of 4
Show