Morpholino
MO2-lmo2
- ID
- ZDB-MRPHLNO-080625-2
- Name
- MO2-lmo2
- Previous Names
-
- lmo2 atgMO2 (1)
- Target
- Sequence
-
5' - GTAGAAGCCATTTTCAATATGATTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lmo2
No data available
Phenotype
Phenotype resulting from MO2-lmo2
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO2-lmo2
1 - 5 of 11 Show all
Citations
- Matrone, G., Meng, S., Gu, Q., Lv, J., Fang, L., Chen, K., Cooke, J.P. (2017) Lmo2 (LIM-Domain-Only 2) Modulates Sphk1 (Sphingosine Kinase) and Promotes Endothelial Cell Migration. Arteriosclerosis, Thrombosis, and Vascular Biology. 37(10):1860-1868
- Meng, S., Matrone, G., Lv, J., Chen, K., Wong, W.T., Cooke, J.P. (2016) LIM Domain Only 2 Regulates Endothelial Proliferation, Angiogenesis, and Tissue Regeneration. Journal of the American Heart Association. 5(10)
- Lalwani, M.K., Sharma, M., Singh, A.R., Chauhan, R.K., Patowary, A., Singh, N., Scaria, V., and Sivasubbu, S. (2012) Reverse Genetics Screen in Zebrafish Identifies a Role of miR-142a-3p in Vascular Development and Integrity. PLoS One. 7(12):e52588
- Patterson, L.J., Gering, M., Eckfeldt, C.E., Green, A.R., Verfaillie, C.M., Ekker, S.C., and Patient, R. (2007) The transcription factors, Scl and Lmo2, act together during development of the hemangioblast in zebrafish. Blood. 109(6):2389-2398
1 - 4 of 4
Show