Morpholino

MO1-cep290

ID
ZDB-MRPHLNO-080428-2
Name
MO1-cep290
Previous Names
  • ATG-MO (1)
  • MO6-cep290
Target
Sequence
5' - GCCGCAGGCATTCTTCAGGTCAGCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cep290
Expressed Gene Anatomy Figures
cep290 Fig. 1. with image from Cardenas-Rodriguez et al., 2021
Fig. 4 from Murga-Zamalloa et al., 2011
pebp1 Fig. 4 from Murga-Zamalloa et al., 2011
Phenotype
Phenotype resulting from MO1-cep290
Phenotype Fish Figures
axis curved, abnormal AB/TU + MO1-cep290 Fig. 1. with image from Cardenas-Rodriguez et al., 2021
axis curved ventral, abnormal AB/TU + MO1-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
brain hydrocephalic, abnormal WT + MO1-cep290 Fig. S1 from Slaats et al., 2015
Fig. 4 from Murga-Zamalloa et al., 2011
brain infiltrative, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
cerebellum organization quality, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
cerebellum development disrupted, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
cerebellum structural organization disrupted, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
cloacal septation disrupted, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
eye decreased size, abnormal WT + MO1-cep290 Fig. S1 from Slaats et al., 2015
Fig. 4 from Murga-Zamalloa et al., 2011
Fig. 3 from Sayer et al., 2006
fourth ventricle composition, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
heart determination of heart left/right asymmetry process quality, abnormal AB/TU + MO1-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
kidney cystic, abnormal AB/TU + MO1-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
nervous system development disrupted, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
otic vesicle formation disrupted, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
otolith amount, abnormal AB/TU + MO1-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
pericardium edematous, abnormal WT + MO1-cep290 Fig. S1 from Slaats et al., 2015
Fig. 4 from Murga-Zamalloa et al., 2011
post-vent region curved, abnormal AB/TU + MO1-cep290 Fig. 1. with image from Cardenas-Rodriguez et al., 2021
post-vent region curved ventral, abnormal AB/TU + MO1-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
Fig. 4 from Murga-Zamalloa et al., 2011
post-vent region increased curvature, abnormal WT + MO1-cep290 Fig. 4 from Murga-Zamalloa et al., 2011
pronephric glomerulus cystic, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
pronephric tubule cystic, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
retinal photoreceptor layer lacks all parts of type photoreceptor cell photoreceptor outer segment, abnormal WT + MO1-cep290 Fig. 4 from Murga-Zamalloa et al., 2011
signal transduction in response to DNA damage increased magnitude, abnormal WT + MO1-cep290 Fig. 1 from Slaats et al., 2015
trunk curved ventral, abnormal WT + MO1-cep290 Fig. S1 from Slaats et al., 2015
whole organism cep290 expression absent, abnormal AB/TU + MO1-cep290 Fig. 1. with image from Cardenas-Rodriguez et al., 2021
whole organism dead, abnormal WT + MO1-cep290 Fig. S1 from Slaats et al., 2015
whole organism decreased pigmentation, abnormal WT + MO1-cep290 Fig. S1 from Slaats et al., 2015
Phenotype of all Fish created by or utilizing MO1-cep290
Phenotype Fish Conditions Figures
axis curved, abnormal AB/TU + MO1-cep290 control Fig. 1. with image from Cardenas-Rodriguez et al., 2021
otolith amount, abnormal AB/TU + MO1-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
kidney cystic, abnormal AB/TU + MO1-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
axis curved ventral, abnormal AB/TU + MO1-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
heart determination of heart left/right asymmetry process quality, abnormal AB/TU + MO1-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
whole organism cep290 expression absent, abnormal AB/TU + MO1-cep290 control Fig. 1. with image from Cardenas-Rodriguez et al., 2021
post-vent region curved, abnormal AB/TU + MO1-cep290 control Fig. 1. with image from Cardenas-Rodriguez et al., 2021
post-vent region curved ventral, abnormal AB/TU + MO1-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
post-vent region curved ventral, abnormal WT + MO1-cep290 standard conditions Fig. 4 from Murga-Zamalloa et al., 2011
cerebellum structural organization disrupted, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
post-vent region increased curvature, abnormal WT + MO1-cep290 standard conditions Fig. 4 from Murga-Zamalloa et al., 2011
nervous system development disrupted, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
pronephric glomerulus cystic, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
brain infiltrative, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
brain hydrocephalic, abnormal WT + MO1-cep290 standard conditions Fig. S1 from Slaats et al., 2015
Fig. 4 from Murga-Zamalloa et al., 2011
otic vesicle formation disrupted, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
retinal photoreceptor layer lacks all parts of type photoreceptor cell photoreceptor outer segment, abnormal WT + MO1-cep290 standard conditions Fig. 4 from Murga-Zamalloa et al., 2011
whole organism decreased pigmentation, abnormal WT + MO1-cep290 standard conditions Fig. S1 from Slaats et al., 2015
eye decreased size, abnormal WT + MO1-cep290 standard conditions Fig. S1 from Slaats et al., 2015
Fig. 4 from Murga-Zamalloa et al., 2011
Fig. 3 from Sayer et al., 2006
fourth ventricle composition, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
pronephric tubule cystic, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
trunk curved ventral, abnormal WT + MO1-cep290 standard conditions Fig. S1 from Slaats et al., 2015
whole organism dead, abnormal WT + MO1-cep290 standard conditions Fig. S1 from Slaats et al., 2015
cerebellum organization quality, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
cerebellum development disrupted, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
signal transduction in response to DNA damage increased magnitude, abnormal WT + MO1-cep290 standard conditions Fig. 1 from Slaats et al., 2015
pericardium edematous, abnormal WT + MO1-cep290 standard conditions Fig. S1 from Slaats et al., 2015
Fig. 4 from Murga-Zamalloa et al., 2011
cloacal septation disrupted, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
pronephros cystic, abnormal cc2d2aw38/w38 + MO1-cep290 (AB) standard conditions text only from Gorden et al., 2008
pronephros cystic, exacerbated cc2d2aw38/w38 + MO1-cep290 (AB) standard conditions Fig. 6 from Gorden et al., 2008
eye lacks all parts of type lens, abnormal WT + MO1-cep290 + MO2-mkks standard conditions Fig. 3 from Rachel et al., 2012
tether cell decreased size, abnormal WT + MO1-cep290 + MO2-mkks standard conditions Fig. 3 from Rachel et al., 2012
eye development disrupted, abnormal WT + MO1-cep290 + MO2-mkks standard conditions Fig. 3 from Rachel et al., 2012
ear development disrupted, abnormal WT + MO1-cep290 + MO2-mkks standard conditions Fig. 3 from Rachel et al., 2012
retina layer formation disrupted, abnormal WT + MO1-cep290 + MO2-mkks standard conditions Fig. 3 from Rachel et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.