Morpholino
MO6-psen1
- ID
- ZDB-MRPHLNO-080422-3
- Name
- MO6-psen1
- Previous Names
- Target
- Sequence
-
5' - GCCAGAAGATCTACACAAGAGCAGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-psen1
No data available
Phenotype
Phenotype resulting from MO6-psen1
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO6-psen1
1 - 5 of 12 Show all
Citations
- Nery, L.R., Silva, N.E., Fonseca, R., Vianna, M.R.M. (2017) Presenilin-1 Targeted Morpholino Induces Cognitive Deficits, Increased Brain Aβ1-42 and Decreased Synaptic Marker PSD-95 in Zebrafish Larvae.. Neurochemical research. 42(10):2959-2967
- Newman, M., Tucker, B., Nornes, S., Ward, A., and Lardelli, M. (2009) Altering presenilin gene activity in zebrafish embryos causes changes in expression of genes with potential involvement in Alzheimer's disease pathogenesis. Journal of Alzheimer's disease : JAD. 16(1):133-147
- Nornes, S., Newman, M., Verdile, G., Wells, S., Stoick-Cooper, C., Tucker, B., Frederich-Sleptsova, I., Martins, R., and Lardelli, M. (2008) Interference with splicing of Presenilin transcripts has potent dominant negative effects on Presenilin activity. Human molecular genetics. 17(3):402-412
1 - 3 of 3
Show