Morpholino
MO1-alpi.1
- ID
- ZDB-MRPHLNO-080325-1
- Name
- MO1-alpi.1
- Previous Names
- None
- Target
- Sequence
-
5' - TGTAAAGTCGTCTTCATCACTCACC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-alpi.1
No data available
Phenotype
Phenotype resulting from MO1-alpi.1
Phenotype | Fish | Figures |
---|---|---|
alkaline phosphatase activity decreased occurrence, abnormal | WT + MO1-alpi.1 |
Fig. 1,
Fig. S1
from Bates et al., 2007 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-alpi.1
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
alkaline phosphatase activity decreased occurrence, abnormal | WT + MO1-alpi.1 | standard conditions |
Fig. 1,
Fig. S1
from Bates et al., 2007 |
1 - 1 of 1
Citations
- Rolig, A.S., Mittge, E.K., Ganz, J., Troll, J.V., Melancon, E., Wiles, T.J., Alligood, K., Stephens, W.Z., Eisen, J.S., Guillemin, K. (2017) The enteric nervous system promotes intestinal health by constraining microbiota composition. PLoS Biology. 15:e2000689
- Bates, J.M., Akerlund, J., Mittge, E., and Guillemin, K. (2007) Intestinal alkaline phosphatase detoxifies lipopolysaccharide and prevents inflammation in zebrafish in response to the gut microbiota. Cell Host & Microbe. 2(6):371-382
1 - 2 of 2
Show