Morpholino
MO4-nkx2.2a
- ID
- ZDB-MRPHLNO-080321-2
- Name
- MO4-nkx2.2a
- Previous Names
-
- nkx2.2a MO1
- Target
- Sequence
-
5' - CCGTCTTTGTGTTGGTCAACGACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Start site morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-nkx2.2a
No data available
Phenotype
Phenotype resulting from MO4-nkx2.2a
1 - 5 of 15 Show all
Phenotype of all Fish created by or utilizing MO4-nkx2.2a
1 - 5 of 22 Show all
Citations
- Smith, C.J., Morris, A.D., Welsh, T.G., Kucenas, S. (2014) Contact-Mediated Inhibition Between Oligodendrocyte Progenitor Cells and Motor Exit Point Glia Establishes the Spinal Cord Transition Zone. PLoS Biology. 12:e1001961
- Yang, L., Rastegar, S., and Strähle, U. (2010) Regulatory interactions specifying Kolmer-Agduhr interneurons. Development (Cambridge, England). 137(16):2713-2722
- Kucenas, S., Snell, H., and Appel, B. (2008) nkx2.2a promotes specification and differentiation of a myelinating subset of oligodendrocyte lineage cells in zebrafish. Neuron glia biology. 4(2):71-81
- Kucenas, S., Takada, N., Park, H.C., Woodruff, E., Broadie, K., and Appel, B. (2008) CNS-derived glia ensheath peripheral nerves and mediate motor root development. Nature Neuroscience. 11(2):143-151
1 - 4 of 4
Show