Morpholino

MO1-itgb1b

ID
ZDB-MRPHLNO-080319-2
Name
MO1-itgb1b
Previous Names
None
Target
Sequence
5' - AATCAGGAGCAGCCTTACGTCCATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-itgb1b
No data available
Phenotype
Phenotype resulting from MO1-itgb1b
Phenotype Fish Figures
angioblast cell migration from lateral mesoderm to midline process quality, abnormal ncv2Tg + MO1-itgb1b Fig. 5 with image from Rho et al., 2019
brain hemorrhagic, abnormal WT + MO1-itgb1b Fig. 8 from Wu et al., 2015
cardiac muscle Z disc EGFP expression spatial pattern, abnormal pku316Tg + MO1-itgb1b (TL) Fig. 5 from Wu et al., 2015
cardiac muscle cell Z disc decreased amount, abnormal WT + MO1-itgb1b Fig. 8 from Wu et al., 2015
cardiac muscle cell Z disc disorganized, abnormal WT + MO1-itgb1b Fig. 5 from Wu et al., 2015
cardiac ventricle decreased volume, abnormal WT + MO1-itgb1b Fig. 8 from Wu et al., 2015
dorsal aorta decreased diameter, abnormal la116Tg + MO1-itgb1b Fig. 8 from Wu et al., 2015
intersegmental vessel GFP expression decreased amount, abnormal la116Tg + MO1-itgb1b Fig. 8 from Wu et al., 2015
posterior cardinal vein decreased diameter, abnormal la116Tg + MO1-itgb1b Fig. 8 from Wu et al., 2015
posterior lateral plate mesoderm cell decreased adhesivity, abnormal hzm7Et; ncv2Tg + MO1-itgb1b Fig. 5 with image from Rho et al., 2019
posterior lateral plate mesoderm cell morphology, abnormal ncv2Tg + MO1-itgb1b Fig. 5 with image from Rho et al., 2019
vascular cord EGFP expression decreased amount, abnormal ncv1Tg; um14Tg + MO1-itgb1b Fig. 6 with image from Rho et al., 2019
vascular cord Notch signaling pathway decreased occurrence, abnormal ncv1Tg; um14Tg + MO1-itgb1b Fig. 6 with image from Rho et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-itgb1b Fig. 6 with image from Rho et al., 2019
ventricular myocardium striated muscle thin filament ab1-tpm labeling decreased amount, abnormal WT + MO1-itgb1b Fig. 8 from Wu et al., 2015
ventricular myocardium Z disc ab1-actn labeling decreased amount, abnormal WT + MO1-itgb1b Fig. 8 from Wu et al., 2015
Phenotype of all Fish created by or utilizing MO1-itgb1b
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-itgb1b control Fig. 6 with image from Rho et al., 2019
ventricular myocardium striated muscle thin filament ab1-tpm labeling decreased amount, abnormal WT + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
cardiac muscle cell Z disc decreased amount, abnormal WT + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
cardiac ventricle decreased volume, abnormal WT + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
cardiac muscle cell Z disc disorganized, abnormal WT + MO1-itgb1b standard conditions Fig. 5 from Wu et al., 2015
ventricular myocardium Z disc ab1-actn labeling decreased amount, abnormal WT + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
brain hemorrhagic, abnormal WT + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
dorsal aorta decreased diameter, abnormal la116Tg + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
posterior cardinal vein decreased diameter, abnormal la116Tg + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
intersegmental vessel GFP expression decreased amount, abnormal la116Tg + MO1-itgb1b standard conditions Fig. 8 from Wu et al., 2015
angioblast cell migration from lateral mesoderm to midline process quality, abnormal ncv2Tg + MO1-itgb1b control Fig. 5 with image from Rho et al., 2019
posterior lateral plate mesoderm cell morphology, abnormal ncv2Tg + MO1-itgb1b control Fig. 5 with image from Rho et al., 2019
cardiac muscle Z disc EGFP expression spatial pattern, abnormal pku316Tg + MO1-itgb1b (TL) standard conditions Fig. 5 from Wu et al., 2015
posterior lateral plate mesoderm cell decreased adhesivity, abnormal hzm7Et; ncv2Tg + MO1-itgb1b control Fig. 5 with image from Rho et al., 2019
vascular cord EGFP expression decreased amount, abnormal ncv1Tg; um14Tg + MO1-itgb1b control Fig. 6 with image from Rho et al., 2019
vascular cord Notch signaling pathway decreased occurrence, abnormal ncv1Tg; um14Tg + MO1-itgb1b control Fig. 6 with image from Rho et al., 2019
ventricular myocardium Z disc ab1-actn labeling decreased amount, abnormal WT + MO1-itgb1b + MO1-tln1 standard conditions Fig. 8 from Wu et al., 2015
ventral wall of dorsal aorta runx1 expression amount, ameliorated kca3Tg; kca4Tg + MO1-itgb1b heat shock Fig. 6 with image from Rho et al., 2019
Citations