Morpholino
MO1-neurod1
- ID
- ZDB-MRPHLNO-080317-1
- Name
- MO1-neurod1
- Previous Names
- None
- Target
- Sequence
-
5' - TGACTTCGTCATGTCGGAACTCTAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-neurod1
No data available
Phenotype
Phenotype resulting from MO1-neurod1
1 - 5 of 32 Show all
Phenotype of all Fish created by or utilizing MO1-neurod1
1 - 5 of 64 Show all
Citations
- Dalgin, G., Prince, V.E. (2015) Differential levels of Neurod establish zebrafish endocrine pancreas cell fates. Developmental Biology. 402(1):81-97
- Taylor, S.M., Alvarez-Delfin, K., Saade, C.J., Thomas, J.L., Thummel, R., Fadool, J.M., Hitchcock, P.F. (2015) The bHLH Transcription Factor NeuroD Governs Photoreceptor Genesis and Regeneration Through Delta-Notch Signaling. Investigative ophthalmology & visual science. 56:7496-7515
- Laranjeiro, R., Whitmore, D. (2014) Transcription factors involved in retinogenesis are co-opted by the circadian clock following photoreceptor differentiation. Development (Cambridge, England). 141(13):2644-56
- Arkhipova, V., Wendik, B., Devos, N., Ek, O., Peers, B., and Meyer, D. (2012) Characterization and regulation of the hb9/mnx1 beta-cell progenitor specific enhancer in zebrafish. Developmental Biology. 365(1):290-302
- Sapède, D., Dyballa, S., and Pujades, C. (2012) Cell lineage analysis reveals three different progenitor pools for neurosensory elements in the otic vesicle. The Journal of neuroscience : the official journal of the Society for Neuroscience. 32(46):16424-16434
- Ochocinska, M.J., and Hitchcock, P.F. (2009) NeuroD regulates proliferation of photoreceptor progenitors in the retina of the zebrafish. Mechanisms of Development. 126(3-4):128-141
- Sarrazin, A.F., Villablanca, E.J., Nunez, V.A., Sandoval, P.C., Ghysen, A., and Allende, M.L. (2006) Proneural gene requirement for hair cell differentiation in the zebrafish lateral line. Developmental Biology. 295(2):534-545
1 - 7 of 7
Show