Morpholino

MO1-tdp2b

ID
ZDB-MRPHLNO-080307-1
Name
MO1-tdp2b
Previous Names
  • MO1-tdp2
  • MO1-ttrap
  • MO1-ttrapl
Target
Sequence
5' - TTAAAGCTCTCTCCATGTCCCACTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tdp2b
Phenotype
Phenotype resulting from MO1-tdp2b
Phenotype of all Fish created by or utilizing MO1-tdp2b
Phenotype Fish Conditions Figures
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-tdp2b standard conditions Fig. 1 with image from Esguerra et al., 2007
heart looping disrupted, abnormal WT + MO1-tdp2b standard conditions Fig. 1 with imagetext only from Esguerra et al., 2007
determination of left/right symmetry disrupted, abnormal WT + MO1-tdp2b standard conditions Fig. 3 with imagetext only from Esguerra et al., 2007
germ ring increased thickness, abnormal WT + MO1-tdp2b standard conditions text only from Esguerra et al., 2007
heart bifurcated, abnormal WT + MO1-tdp2b standard conditions Fig. 1 with image from Esguerra et al., 2007
polster aplastic, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions Fig. 2 with image from Esguerra et al., 2007
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions Fig. 2 with image from Esguerra et al., 2007
heart looping disrupted, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions text only from Esguerra et al., 2007
forerunner cell group position, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions Fig. 9 with image from Esguerra et al., 2007
germ ring increased thickness, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions Fig. 2 with image from Esguerra et al., 2007
eye decreased size, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions Fig. 2 with image from Esguerra et al., 2007
pericardium edematous, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions text only from Esguerra et al., 2007
heart bifurcated, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions text only from Esguerra et al., 2007
shield morphology, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions Fig. 2 with image from Esguerra et al., 2007
Kupffer's vesicle aplastic, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions Fig. 4 with image from Esguerra et al., 2007
blood circulation disrupted, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions text only from Esguerra et al., 2007
whole organism decreased length, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions Fig. 2 with image from Esguerra et al., 2007
head decreased size, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions Fig. 2 with image from Esguerra et al., 2007
vasculature development disrupted, abnormal WT + MO1-tdp2b + MO2-tdp2b standard conditions text only from Esguerra et al., 2007
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-smad2 + MO1-tdp2b + MO2-tdp2b standard conditions text only from Esguerra et al., 2007
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-smad3b + MO1-tdp2b + MO2-tdp2b standard conditions text only from Esguerra et al., 2007
Kupffer's vesicle morphology, abnormal WT + MO1-smad3b + MO1-tdp2b + MO2-tdp2b standard conditions text only from Esguerra et al., 2007
gastrulation disrupted, abnormal WT + MO1-smad3b + MO1-tdp2b + MO2-tdp2b standard conditions text only from Esguerra et al., 2007
heart looping disrupted, abnormal WT + MO1-snai1a + MO1-tdp2b standard conditions text only from Esguerra et al., 2007
Citations