Morpholino

MO1-tbpl2

ID

ZDB-MRPHLNO-080303-1

Name

MO1-tbpl2

Previous Names

trf3-MO (1)

Target

tbpl2 (1)

Sequence

5' - GATGCCTCCTCATCCATGTTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a translation blocking morpholino.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tbpl2

Expressed Gene	Anatomy	Figures
bmp4	unspecified	Fig. 1 from Hart et al., 2007
cdx1a	whole organism	Fig. S9 from Hart et al., 2007
cdx4	margin (not) whole organism	Fig. 3, Fig. S9 from Hart et al., 2007
dck	whole organism	Fig. 1 from Hart et al., 2007
gapdh	whole organism	Fig. 4 from Hart et al., 2009 Fig. 3, Fig. S7, Fig. S9 from Hart et al., 2007
gata1a	(not) lateral mesoderm posterior lateral mesoderm (not) whole organism	Fig. 4 from Hart et al., 2009 Fig. 1, Fig. 2, Fig. 3, Fig. S7 from Hart et al., 2007
gata2a	lateral mesoderm whole organism	Fig. 2, Fig. S7 from Hart et al., 2007
hbae1.1	intermediate cell mass of mesoderm whole organism	Fig. 4 from Hart et al., 2009 Fig. S6, Fig. S7 from Hart et al., 2007
hbae3	(not) whole organism	Fig. S7 from Hart et al., 2007
hoxa9a	tail bud	Fig. S8 from Hart et al., 2007
hoxb5a	(not) notochord	Fig. S8 from Hart et al., 2007
hoxb7a	(not) tail bud	Fig. S8 from Hart et al., 2007
kdrl	lateral mesoderm	Fig. 2 from Hart et al., 2007
lmo2	lateral mesoderm whole organism	Fig. 4 from Hart et al., 2009 Fig. 2, Fig. S7 from Hart et al., 2007
mespaa	(not) whole organism	Fig. 1 from Hart et al., 2007
nkx2.5	(not) lateral mesoderm (not) primitive heart tube	Fig. 1, Fig. S6 from Hart et al., 2007
pax2a	lateral mesoderm posterior lateral mesoderm	Fig. 4 from Hart et al., 2009 Fig. 1, Fig. 2 from Hart et al., 2007
shha	axial mesoderm	Fig. 1 from Hart et al., 2007
spi1b	(not) anterior lateral mesoderm whole organism	Fig. 2, Fig. S7 from Hart et al., 2007
syncrip	whole organism	Fig. 1 from Hart et al., 2007
tal1	intermediate cell mass of mesoderm (not) lateral mesoderm whole organism	Fig. 4 from Hart et al., 2009 Fig. 2, Fig. S6, Fig. S7 from Hart et al., 2007
tbp	whole organism	Fig. S1 from Hart et al., 2007
tbpl2	(not) whole organism	Fig. S1 from Hart et al., 2007
tbxta	whole organism	Fig. 1 from Hart et al., 2007

Phenotype

Phenotype resulting from MO1-tbpl2

Phenotype	Fish	Figures
embryo development decreased rate, abnormal	WT + MO1-tbpl2	Fig. 1 from Hart et al., 2009
intermediate cell mass of mesoderm erythroid lineage cell decreased amount, abnormal	WT + MO1-tbpl2	Fig. 4 from Hart et al., 2009
lateral plate mesoderm erythroid progenitor cell decreased amount, abnormal	WT + MO1-tbpl2	Fig. 4 from Hart et al., 2009
trunk curvature, abnormal	WT + MO1-tbpl2	Fig. 1 , Fig. 4 from Hart et al., 2009
whole organism necrotic, abnormal	WT + MO1-tbpl2	Fig. 1 from Hart et al., 2007

Phenotype of all Fish created by or utilizing MO1-tbpl2

Phenotype	Fish	Conditions	Figures
whole organism necrotic, abnormal	WT + MO1-tbpl2	standard conditions	Fig. 1 from Hart et al., 2007
intermediate cell mass of mesoderm erythroid lineage cell decreased amount, abnormal	WT + MO1-tbpl2	standard conditions	Fig. 4 from Hart et al., 2009
trunk curvature, abnormal	WT + MO1-tbpl2	standard conditions	Fig. 1 , Fig. 4 from Hart et al., 2009
lateral plate mesoderm erythroid progenitor cell decreased amount, abnormal	WT + MO1-tbpl2	standard conditions	Fig. 4 from Hart et al., 2009
embryo development decreased rate, abnormal	WT + MO1-tbpl2	standard conditions	Fig. 1 from Hart et al., 2009

Citations