Morpholino
MO1-nr3c1
- ID
- ZDB-MRPHLNO-080229-4
- Name
- MO1-nr3c1
- Previous Names
-
- GR MO
- Target
- Sequence
-
5' - CGGAACCCTAAAATACATGAAGCAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocking morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nr3c1
No data available
Phenotype
Phenotype resulting from MO1-nr3c1
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO1-nr3c1
1 - 5 of 16 Show all
Citations
- Garland, M.A., Sengupta, S., Mathew, L.K., Truong, L., de Jong, E., Piersma, A.H., La Du, J., Tanguay, R.L. (2019) Glucocorticoid receptor-dependent induction of cripto-1 (one-eyed pinhead) inhibits zebrafish caudal fin regeneration. Toxicology reports. 6:529-537
- Yin, G., Cao, L., Du, J., Jia, R., Kitazawa, T., Kubota, A., Teraoka, H. (2017) Dexamethasone-induced hepatomegaly and steatosis in larval zebrafish. The Journal of Toxicological Sciences. 42:455-459
- Lin, C.H., Hu, H.J., Hwang, P.P. (2016) Cortisol regulates sodium homeostasis by stimulating the transcription of sodium-chloride transporter (NCC) in zebrafish (Danio rerio). Molecular and Cellular Endocrinology. 422:93-102
- Lin, C.H., Shih, T.H., Liu, S.T., Hsu, H.H., Hwang, P.P. (2015) Cortisol Regulates Acid Secretion of H(+)-ATPase-rich Ionocytes in Zebrafish (Danio rerio) Embryos. Frontiers in Physiology. 6:328
- Cruz, S.A., Lin, C.H., Chao, P.L., and Hwang, P.P. (2013) Glucocorticoid receptor, but not mineralocorticoid receptor, mediates cortisol regulation of epidermal ionocyte development and ion transport in zebrafish (danio rerio). PLoS One. 8(10):e77997
- Sengupta, S., Bisson, W.H., Mathew, L.K., Kolluri, S.K., and Tanguay, R.L. (2012) Alternate glucocorticoid receptor ligand binding structures influence outcomes in an in vivo tissue regeneration model. Comparative biochemistry and physiology. Toxicology & pharmacology : CBP. 156(2):121-129
- Peal, D.S., Mills, R.W., Lynch, S.N., Mosley, J.M., Lim, E., Ellinor, P.T., January, C.T., Peterson, R.T., and Milan, D.J. (2011) Novel Chemical Suppressors of Long QT Syndrome Identified by an In Vivo Functional Screen. Circulation. 123(1):23-30
- Mathew, L.K., Sengupta, S., Kawakami, A., Andreasen, E.A., Löhr, C.V., Loynes, C.A., Renshaw, S.A., Peterson, R.T., and Tanguay, R.L. (2007) Unraveling tissue regeneration pathways using chemical genetics. The Journal of biological chemistry. 282(48):35202-35210
1 - 8 of 8
Show