Morpholino
MO1-foxh1
- ID
- ZDB-MRPHLNO-080110-1
- Name
- MO1-foxh1
- Previous Names
- None
- Target
- Sequence
-
5' - TGCTTTGTCATGCTGATGTAGTGGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-foxh1
No data available
Phenotype
Phenotype resulting from MO1-foxh1
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-foxh1
1 - 5 of 7 Show all
Citations
- Joseph, S.R., Pálfy, M., Hilbert, L., Kumar, M., Karschau, J., Zaburdaev, V., Shevchenko, A., Vastenhouw, N.L. (2017) Competition between histone and transcription factor binding regulates the onset of transcription in zebrafish embryos. eLIFE. 6
- Moreno-Ayala, R., Schnabel, D., Salas-Vidal, E., Lomelí, H. (2015) PIAS-like protein Zimp7 is required for the restriction of the Zebrafish organizer and mesoderm development. Developmental Biology. 403(1):89-100
- van Boxtel, A.L., Chesebro, J.E., Heliot, C., Ramel, M.C., Stone, R.K., Hill, C.S. (2015) A Temporal Window for Signal Activation Dictates the Dimensions of a Nodal Signaling Domain. Developmental Cell. 35:175-185
- Nelson, A.C., Cutty, S.J., Niini, M., Stemple, D.L., Flicek, P., Houart, C., Bruce, A., Wardle, F.C. (2014) Global identification of Smad2 and Eomesodermin targets in zebrafish identifies a conserved transcriptional network in mesendoderm and a novel role for Eomesodermin in repression of ectodermal gene expression. BMC Biology. 12:81
- Slagle, C.E., Aoki, T., and Burdine, R.D. (2011) Nodal-Dependent Mesendoderm Specification Requires the Combinatorial Activities of FoxH1 and Eomesodermin. PLoS Genetics. 7(5):e1002072
- Pei, W., Noushmehr, H., Costa, J., Ouspenskaia, M.V., Elkahloun, A.G., and Feldman, B. (2007) An early requirement for maternal FoxH1 during zebrafish gastrulation. Developmental Biology. 310(1):10-22
1 - 6 of 6
Show