Morpholino
MO1-arhgef7b
- ID
- ZDB-MRPHLNO-071213-1
- Name
- MO1-arhgef7b
- Previous Names
-
- bPixexon6 (1)
- Target
- Sequence
-
5' - GCGCATCTCTCTTACCACATTATAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-arhgef7b
No data available
Phenotype
Phenotype resulting from MO1-arhgef7b
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-arhgef7b
1 - 5 of 5
Citations
- Liu, J., Zeng, L., Kennedy, R.M., Gruenig, N.M., and Childs, S.J. (2012) betaPix plays a dual role in cerebral vascular stability and angiogenesis, and interacts with integrin alphavbeta8. Developmental Biology. 363(1):95-105
- Gore, A.V., Lampugnani, M.G., Dye, L., Dejana, E., and Weinstein, B.M. (2008) Combinatorial interaction between CCM pathway genes precipitates hemorrhagic stroke. Disease models & mechanisms. 1(4-5):275-281
- Liu, J., Fraser, S.D., Faloon, P.W., Rollins, E.L., Vom Berg, J., Starovic-Subota, O., Laliberte, A.L., Chen, J.N., Serluca, F.C., and Childs, S.J. (2007) A βPix–Pak2a signaling pathway regulates cerebral vascular stability in zebrafish. Proceedings of the National Academy of Sciences of the United States of America. 104(35):13990-13995
1 - 3 of 3
Show