Morpholino

MO1-sema3fb

ID
ZDB-MRPHLNO-071205-6
Name
MO1-sema3fb
Previous Names
  • sema3f2 AMO (1)
Target
Sequence
5' - CATAGACTGTCCAAGAGCATGGTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sema3fb
No data available
Phenotype
Phenotype resulting from MO1-sema3fb
Phenotype Fish Figures
caudal vein plexus dilated, abnormal y1Tg + MO1-sema3fb Fig. 6 with image from Petrova et al., 2025
caudal vein plexus increased accumulation blood cell, abnormal y1Tg + MO1-sema3fb Fig. 6 with image from Petrova et al., 2025
dorsal longitudinal anastomotic vessel morphology, abnormal y1Tg + MO1-sema3fb Fig. 6 with image from Petrova et al., 2025
intersegmental vein malformed, abnormal y1Tg + MO1-sema3fb Fig. 6 with image from Petrova et al., 2025
intersegmental vein angiogenic sprout mislocalised, abnormal y1Tg + MO1-sema3fb Fig. 6 with image from Petrova et al., 2025
intersegmental vein dorsal longitudinal anastomotic vessel disconnected, abnormal y1Tg + MO1-sema3fb Fig. 6 with image from Petrova et al., 2025
pericardium edematous, abnormal y1Tg + MO1-sema3fb Fig. 6 with image from Petrova et al., 2025
whole organism viability, abnormal y1Tg + MO1-sema3fb Fig. 6 with image from Petrova et al., 2025
Phenotype of all Fish created by or utilizing MO1-sema3fb
Phenotype Fish Conditions Figures
intersegmental vein malformed, abnormal y1Tg + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
dorsal longitudinal anastomotic vessel morphology, abnormal y1Tg + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
whole organism viability, abnormal y1Tg + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
intersegmental vein dorsal longitudinal anastomotic vessel disconnected, abnormal y1Tg + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
pericardium edematous, abnormal y1Tg + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
intersegmental vein angiogenic sprout mislocalised, abnormal y1Tg + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
caudal vein plexus dilated, abnormal y1Tg + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
caudal vein plexus increased accumulation blood cell, abnormal y1Tg + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
rhombomere neuron differentiation increased occurrence, abnormal tp53zdf1/zdf1 + MO1-sema3fb + MO1-sema3gb standard conditions Fig. 5 with image from Terriente et al., 2012
rhombomere pattern specification process occurrence, abnormal tp53zdf1/zdf1 + MO1-sema3fb + MO1-sema3gb standard conditions Fig. 5 with image from Terriente et al., 2012
neuroectoderm pattern specification process occurrence, abnormal tp53zdf1/zdf1 + MO1-sema3fb + MO1-sema3gb standard conditions Fig. 5 with image from Terriente et al., 2012
dorsal longitudinal anastomotic vessel morphology, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
whole organism viability, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
intersegmental vein dorsal longitudinal anastomotic vessel disconnected, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
pericardium edematous, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
intersegmental vein angiogenic sprout mislocalised, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
caudal vein plexus dilated, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
intersegmental vein malformed, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
caudal vein plexus increased accumulation blood cell, abnormal y1Tg + MO1-sema3fa + MO1-sema3fb control Fig. 6 with image from Petrova et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.