Morpholino
MO3-spi1b
- ID
- ZDB-MRPHLNO-071203-2
- Name
- MO3-spi1b
- Previous Names
-
- MO3-spi1
- Target
- Sequence
-
5' - GGTCTTTCTCCTTACCATGCTCTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
splice-blocker targeted to exon 4-5 boundary
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-spi1b
No data available
Phenotype
Phenotype resulting from MO3-spi1b
Phenotype | Fish | Figures |
---|---|---|
macrophage differentiation disrupted, abnormal | WT + MO3-spi1b |
Fig. 4
from Su et al., 2007 |
myeloid cell decreased amount, abnormal | WT + MO3-spi1b |
Fig. 4
from Su et al., 2007 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO3-spi1b
1 - 5 of 24 Show all
Citations
- Liang, H., Li, M., Chen, J., Zhou, W., Xia, D., Ding, Q., Yang, Y., Zhang, Z., Ran, C., Zhou, Z. (2024) The intestinal microbiome and Cetobacterium somerae inhibit viral infection through TLR2-type I IFN signaling axis in zebrafish. Microbiome. 12:244244
- Nielson, J.A., Davis, J.M. (2023) Roles for Microglia in Cryptococcal Brain Dissemination in the Zebrafish Larva. Microbiology spectrum. 11(2):e0431522
- Scherer, A.K., Blair, B.A., Park, J., Seman, B.G., Kelley, J.B., Wheeler, R.T. (2020) Redundant Trojan horse and endothelial-circulatory mechanisms for host-mediated spread of Candida albicans yeast. PLoS pathogens. 16:e1008414
- Cambier, C.J., O'Leary, S.M., O'Sullivan, M.P., Keane, J., Ramakrishnan, L. (2017) Phenolic Glycolipid Facilitates Mycobacterial Escape from Microbicidal Tissue-Resident Macrophages. Immunity. 47(3):552-565.e4
- Madigan, C.A., Cambier, C.J., Kelly-Scumpia, K.M., Scumpia, P.O., Cheng, T.Y., Zailaa, J., Bloom, B.R., Moody, D.B., Smale, S.T., Sagasti, A., Modlin, R.L., Ramakrishnan, L. (2017) A Macrophage Response to Mycobacterium leprae Phenolic Glycolipid Initiates Nerve Damage in Leprosy. Cell. 170:973-985.e10
- Mesureur, J., Feliciano, J.R., Wagner, N., Gomes, M.C., Zhang, L., Blanco-Gonzalez, M., van der Vaart, M., O'Callaghan, D., Meijer, A.H., Vergunst, A.C. (2017) Macrophages, but not neutrophils, are critical for proliferation of Burkholderia cenocepacia and ensuing host-damaging inflammation. PLoS pathogens. 13:e1006437
- Halloum, I., Carrère-Kremer, S., Blaise, M., Viljoen, A., Bernut, A., Le Moigne, V., Vilchèze, C., Guérardel, Y., Lutfalla, G., Herrmann, J.L., Jacobs, W.R., Kremer, L. (2016) Deletion of a dehydratase important for intracellular growth and cording renders rough Mycobacterium abscessus avirulent. Proceedings of the National Academy of Sciences of the United States of America. 113(29):E4228-37
- Willis, A.R., Moore, C., Mazon-Moya, M., Krokowski, S., Lambert, C., Till, R., Mostowy, S., Sockett, R.E. (2016) Injections of Predatory Bacteria Work Alongside Host Immune Cells to Treat Shigella Infection in Zebrafish Larvae. Current biology : CB. 26(24):3343-3351
- Belon, C., Soscia, C., Bernut, A., Laubier, A., Bleves, S., Blanc-Potard, A.B. (2015) A Macrophage Subversion Factor Is Shared by Intracellular and Extracellular Pathogens. PLoS pathogens. 11:e1004969
- Bernut, A., Dupont, C., Sahuquet, A., Herrmann, J.L., Lutfalla, G., Kremer, L. (2015) Deciphering and Imaging Pathogenesis and Cording of Mycobacterium abscessus in Zebrafish Embryos. Journal of visualized experiments : JoVE. (103):e53130
1 - 10 of 19
Show