Morpholino
MO1-map2k4a
- ID
- ZDB-MRPHLNO-071126-4
- Name
- MO1-map2k4a
- Previous Names
-
- MKK4-MO (1)
- MO1-map2k4
- Target
- Sequence
-
5' - GCCATCTTGTTGACCGAGCCATACG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-map2k4a
No data available
Phenotype
Phenotype resulting from MO1-map2k4a
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-map2k4a
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| dorsal/ventral pattern formation disrupted, abnormal | WT + MO1-map2k4a | standard conditions |
Fig. 5 
from Rui et al., 2007 |
| whole organism wholly ventralized, abnormal | WT + MO1-map2k4a | standard conditions |
Fig. 5
from Rui et al., 2007 |
1 - 2 of 2
Citations
- Seo, J., Asaoka, Y., Nagai, Y., Hirayama, J., Yamasaki, T., Namae, M., Ohata, S., Shimizu, N., Negishi, T., Kitagawa, D., Kondoh, H., Furutani-Seiki, M., Penninger, J.M., Katada, T., and Nishina, H. (2010) Negative regulation of wnt11 expression by Jnk signaling during zebrafish gastrulation. Journal of cellular biochemistry. 110(4):1022-1037
- Rui, Y., Xu, Z., Xiong, B., Cao, Y., Lin, S., Zhang, M., Chan, S.C., Luo, W., Han, Y., Lu, Z., Ye, Z., Zhou, H.M., Han, J., Meng, A., and Lin, S.C. (2007) A beta-Catenin-Independent Dorsalization Pathway Activated by Axin/JNK Signaling and Antagonized by Aida. Developmental Cell. 13(2):268-282
1 - 2 of 2
Show