Morpholino

MO3-bmper

ID
ZDB-MRPHLNO-071005-1
Name
MO3-bmper
Previous Names
None
Target
Sequence
5' - TTGGATGATCTTACCGGTGATTAAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-bmper
Expressed Gene Anatomy Figures
efnb2a Fig. 1 from Esser et al., 2018
ephb4a Fig. 2 from Esser et al., 2018
eve1 Fig. 3 with image from Zhang et al., 2010
otx2b Fig. 3 with image from Zhang et al., 2010
Phenotype
Phenotype resulting from MO3-bmper
Phenotype Fish Figures
blood cell decreased amount, abnormal WT + MO3-bmper Fig. 5 from Moser et al., 2007
blood circulation disrupted, abnormal WT + MO3-bmper Fig. 4,  Fig. 5 from Moser et al., 2007
caudal artery ephb4a expression increased distribution, abnormal y1Tg + MO3-bmper Fig. 2 from Esser et al., 2018
caudal vein aplastic, abnormal zf531Tg + MO3-bmper Fig. 7 from Moser et al., 2007
caudal vein morphology, abnormal zf531Tg + MO3-bmper Fig. 7 from Moser et al., 2007
caudal vein plexus absent, abnormal y1Tg + MO3-bmper Fig. 8 with image from Heinke et al., 2013
caudal vein plexus dilated, abnormal y1Tg + MO3-bmper Fig. 1,  Fig. 2 from Esser et al., 2018
caudal vein plexus ephb4a expression increased amount, abnormal y1Tg + MO3-bmper Fig. 2 from Esser et al., 2018
caudal vein plexus efnb2a expression increased amount, abnormal y1Tg + MO3-bmper Fig. 1 from Esser et al., 2018
caudal vein plexus efnb2a expression increased distribution, abnormal y1Tg + MO3-bmper Fig. 1 from Esser et al., 2018
caudal vein plexus ephb4a expression increased distribution, abnormal y1Tg + MO3-bmper Fig. 2 from Esser et al., 2018
caudal vein plexus efnb2a expression mislocalised, abnormal y1Tg + MO3-bmper Fig. 1 from Esser et al., 2018
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO3-bmper Fig. 8 with image from Heinke et al., 2013
hemopoiesis disrupted, abnormal la781Tg + MO3-bmper Fig. 6 from Moser et al., 2007
intermediate cell mass of mesoderm morphology, abnormal la781Tg + MO3-bmper Fig. 6 from Moser et al., 2007
intersegmental vein malformed, abnormal y1Tg + MO3-bmper Fig. 8 with image from Heinke et al., 2013
intersegmental vessel morphology, abnormal zf531Tg + MO3-bmper Fig. 7 from Moser et al., 2007
post-vent region wholly dorsalized, abnormal WT + MO3-bmper Fig. 4 from Moser et al., 2007
post-vent vasculature morphology, abnormal zf531Tg + MO3-bmper Fig. 7 from Moser et al., 2007
somite decreased size, abnormal WT + MO3-bmper Fig. 4 from Moser et al., 2007
somite morphology, abnormal WT + MO3-bmper Fig. 4 from Moser et al., 2007
sprouting angiogenesis process quality, abnormal y1Tg + MO3-bmper Fig. 8 with image from Heinke et al., 2013
whole organism wholly dorsalized, abnormal WT + MO3-bmper Fig. 3 with image from Zhang et al., 2010
Phenotype of all Fish created by or utilizing MO3-bmper
Phenotype Fish Conditions Figures
blood circulation disrupted, abnormal WT + MO3-bmper standard conditions Fig. 4,  Fig. 5 from Moser et al., 2007
somite morphology, abnormal WT + MO3-bmper standard conditions Fig. 4 from Moser et al., 2007
whole organism wholly dorsalized, abnormal WT + MO3-bmper standard conditions Fig. 3 with image from Zhang et al., 2010
somite decreased size, abnormal WT + MO3-bmper standard conditions Fig. 4 from Moser et al., 2007
post-vent region wholly dorsalized, abnormal WT + MO3-bmper standard conditions Fig. 4 from Moser et al., 2007
blood cell decreased amount, abnormal WT + MO3-bmper standard conditions Fig. 5 from Moser et al., 2007
hemopoiesis disrupted, abnormal la781Tg + MO3-bmper standard conditions Fig. 6 from Moser et al., 2007
intermediate cell mass of mesoderm morphology, abnormal la781Tg + MO3-bmper standard conditions Fig. 6 from Moser et al., 2007
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
intersegmental vein malformed, abnormal y1Tg + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus ephb4a expression increased distribution, abnormal y1Tg + MO3-bmper standard conditions Fig. 2 from Esser et al., 2018
caudal artery ephb4a expression increased distribution, abnormal y1Tg + MO3-bmper standard conditions Fig. 2 from Esser et al., 2018
caudal vein plexus efnb2a expression increased amount, abnormal y1Tg + MO3-bmper standard conditions Fig. 1 from Esser et al., 2018
caudal vein plexus efnb2a expression mislocalised, abnormal y1Tg + MO3-bmper standard conditions Fig. 1 from Esser et al., 2018
caudal vein plexus ephb4a expression increased amount, abnormal y1Tg + MO3-bmper standard conditions Fig. 2 from Esser et al., 2018
sprouting angiogenesis process quality, abnormal y1Tg + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus absent, abnormal y1Tg + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus efnb2a expression increased distribution, abnormal y1Tg + MO3-bmper standard conditions Fig. 1 from Esser et al., 2018
caudal vein plexus dilated, abnormal y1Tg + MO3-bmper standard conditions Fig. 1,  Fig. 2 from Esser et al., 2018
caudal vein aplastic, abnormal zf531Tg + MO3-bmper standard conditions Fig. 7 from Moser et al., 2007
caudal vein morphology, abnormal zf531Tg + MO3-bmper standard conditions Fig. 7 from Moser et al., 2007
post-vent vasculature morphology, abnormal zf531Tg + MO3-bmper standard conditions Fig. 7 from Moser et al., 2007
intersegmental vessel morphology, abnormal zf531Tg + MO3-bmper standard conditions Fig. 7 from Moser et al., 2007
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO3-bmper standard conditions Fig. 3 with image from Zhang et al., 2010
caudal artery ephb4a expression increased distribution, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 2 from Esser et al., 2018
caudal vein plexus efnb2a expression increased amount, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 1 from Esser et al., 2018
caudal vein plexus dilated, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 1,  Fig. 2 from Esser et al., 2018
posterior caudal vein malformed, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus efnb2a expression increased distribution, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 1 from Esser et al., 2018
caudal vein plexus ephb4a expression increased amount, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 2 from Esser et al., 2018
caudal vein plexus efnb2a expression mislocalised, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 1 from Esser et al., 2018
intersegmental vein malformed, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus ephb4a expression increased distribution, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 2 from Esser et al., 2018
sprouting angiogenesis process quality, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.