Morpholino

MO2-htt

ID

ZDB-MRPHLNO-070917-2

Name

MO2-htt

Previous Names

MO2-hd (1)

Target

htt (1)

Sequence

5' - GATATAATCTGATCGGAGATAGGGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-htt

No data available

Phenotype

Phenotype resulting from MO2-htt

Phenotype	Fish	Figures
blood low saturation, abnormal	WT + MO2-htt	Fig. 2 from Lumsden et al., 2007
brain necrotic, abnormal	WT + MO2-htt	Fig. 2, text only from Lumsden et al., 2007
extension aplastic, abnormal	WT + MO2-htt	Fig. 2 from Lumsden et al., 2007
extension decreased size, abnormal	WT + MO2-htt	Fig. 2 from Lumsden et al., 2007
eye decreased size, abnormal	WT + MO2-htt	Fig. 2 from Lumsden et al., 2007
growth delayed, abnormal	WT + MO2-htt	text only from Lumsden et al., 2007
head decreased size, abnormal	WT + MO2-htt	Fig. 2 from Lumsden et al., 2007
pericardium edematous, abnormal	WT + MO2-htt	Fig. 2 from Lumsden et al., 2007
pigment accumulation delayed, abnormal	WT + MO2-htt	Fig. 2 from Lumsden et al., 2007
post-vent region morphology, abnormal	WT + MO2-htt	Fig. 2 from Lumsden et al., 2007
trunk larval melanophore stripe misaligned with whole organism anterior-posterior axis, abnormal	WT + MO2-htt	Fig. 2 from Lumsden et al., 2007
trunk melanocyte disorganized, abnormal	WT + MO2-htt	Fig. 2 from Lumsden et al., 2007
ventricular system decreased size, abnormal	WT + MO2-htt	Fig. 2 from Lumsden et al., 2007
whole organism decreased length, abnormal	WT + MO2-htt	Fig. 2 from Lumsden et al., 2007
whole organism increased curvature, abnormal	WT + MO2-htt	Fig. 2 from Lumsden et al., 2007

Phenotype of all Fish created by or utilizing MO2-htt

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	WT + MO2-htt	standard conditions	Fig. 2 from Lumsden et al., 2007
whole organism increased curvature, abnormal	WT + MO2-htt	standard conditions	Fig. 2 from Lumsden et al., 2007
pigment accumulation delayed, abnormal	WT + MO2-htt	standard conditions	Fig. 2 from Lumsden et al., 2007
head decreased size, abnormal	WT + MO2-htt	standard conditions	Fig. 2 from Lumsden et al., 2007
whole organism decreased length, abnormal	WT + MO2-htt	standard conditions	Fig. 2 from Lumsden et al., 2007
trunk melanocyte disorganized, abnormal	WT + MO2-htt	standard conditions	Fig. 2 from Lumsden et al., 2007
post-vent region morphology, abnormal	WT + MO2-htt	standard conditions	Fig. 2 from Lumsden et al., 2007
growth delayed, abnormal	WT + MO2-htt	standard conditions	text only from Lumsden et al., 2007
extension aplastic, abnormal	WT + MO2-htt	standard conditions	Fig. 2 from Lumsden et al., 2007
trunk larval melanophore stripe misaligned with whole organism anterior-posterior axis, abnormal	WT + MO2-htt	standard conditions	Fig. 2 from Lumsden et al., 2007
ventricular system decreased size, abnormal	WT + MO2-htt	standard conditions	Fig. 2 from Lumsden et al., 2007
extension decreased size, abnormal	WT + MO2-htt	standard conditions	Fig. 2 from Lumsden et al., 2007
brain necrotic, abnormal	WT + MO2-htt	standard conditions	Fig. 2, text only from Lumsden et al., 2007
blood low saturation, abnormal	WT + MO2-htt	standard conditions	Fig. 2 from Lumsden et al., 2007
eye decreased size, abnormal	WT + MO2-htt	standard conditions	Fig. 2 from Lumsden et al., 2007

Citations