Morpholino
MO1-htt
- ID
- ZDB-MRPHLNO-070917-1
- Name
- MO1-htt
- Previous Names
-
- MO1-hd (1)
- Target
- Sequence
-
5' - GCCATTTTAACAGAAGCTGTGATGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-htt
No data available
Phenotype
Phenotype resulting from MO1-htt
1 - 5 of 51 Show all
Phenotype of all Fish created by or utilizing MO1-htt
1 - 5 of 53 Show all
Citations
- Conforti, P., Zuccato, C., Gaudenzi, G., Ieraci, A., Camnasio, S., Buckley, N.J., Mutti, C., Cotelli, F., Contini, A., and Cattaneo, E. (2013) Binding of the repressor complex REST-mSIN3b by small molecules restores neuronal gene transcription in Huntington's disease models. Journal of neurochemistry. 127(1):22-35
- Lo Sardo, V., Zuccato, C., Gaudenzi, G., Vitali, B., Ramos, C., Tartari, M., Myre, M.A., Walker, J.A., Pistocchi, A., Conti, L., Valenza, M., Drung, B., Schmidt, B., Gusella, J., Zeitlin, S., Cotelli, F., and Cattaneo, E. (2012) An evolutionary recent neuroepithelial cell adhesion function of huntingtin implicates ADAM10-Ncadherin. Nature Neuroscience. 15(5):713-721
- Diekmann, H., Anichtchik, O., Fleming, A., Futter, M., Goldsmith, P., Roach, A., and Rubinsztein, D.C. (2009) Decreased BDNF levels are a major contributor to the embryonic phenotype of huntingtin knockdown zebrafish. The Journal of neuroscience : the official journal of the Society for Neuroscience. 29(5):1343-1349
- Futter, M., Diekmann, H., Schoenmakers, E., Sadiq, O., Chatterjee, K., and Rubinsztein, D.C. (2009) Wild-type but not mutant huntingtin modulates the transcriptional activity of liver X receptors. Journal of Medical Genetics. 46(7):438-446
- Henshall, T.L., Tucker, B., Lumsden, A.L., Nornes, S., Lardelli, M.T., and Richards, R.I. (2009) Selective neuronal requirement for Huntingtin in the developing zebrafish. Human molecular genetics. 18(24):4830-4842
- Lumsden, A.L., Henshall, T.L., Dayan, S., Lardelli, M.T., and Richards, R.I. (2007) Huntingtin-deficient zebrafish exhibit defects in iron utilization and development. Human molecular genetics. 16(16):1905-1920
1 - 6 of 6
Show