Morpholino
MO1-ifngr2
- ID
- ZDB-MRPHLNO-070906-9
- Name
- MO1-ifngr2
- Previous Names
-
- MO1-crfb6
- Target
- Sequence
-
5' - GTCATTTCGACAAATATAAATCCAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ifngr2
No data available
Phenotype
Phenotype resulting from MO1-ifngr2
No data available
Phenotype of all Fish created by or utilizing MO1-ifngr2
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| whole organism decreased life span, abnormal | AB + MO1-ifng1r + MO1-ifngr2 | bacterial treatment: Yersinia ruckeri |
Fig. 3
from Aggad et al., 2010 |
1 - 1 of 1
Citations
- Li, Y., Esain, V., Teng, L., Xu, J., Kwan, W., Frost, I.M., Yzaguirre, A.D., Cai, X., Cortes, M., Maijenburg, M.W., Tober, J., Dzierzak, E., Orkin, S.H., Tan, K., North, T.E., Speck, N.A. (2014) Inflammatory signaling regulates embryonic hematopoietic stem and progenitor cell production. Genes & Development. 28(23):2597-612
- Aggad, D., Stein, C., Sieger, D., Mazel, M., Boudinot, P., Herbomel, P., Levraud, J.P., Lutfalla, G., and Leptin, M. (2010) In Vivo Analysis of Ifn-γ1 and Ifn-γ2 Signaling in Zebrafish. Journal of immunology (Baltimore, Md. : 1950). 185(11):6774-6782
- Levraud, J.P., Boudinot, P., Colin, I., Benmansour, A., Peyriéras, N., Herbomel, P., and Lutfalla, G. (2007) Identification of the Zebrafish IFN Receptor: Implications for the Origin of the Vertebrate IFN System. Journal of immunology (Baltimore, Md. : 1950). 178(7):4385-4394
1 - 3 of 3
Show