Morpholino

MO2-amot

ID

ZDB-MRPHLNO-070906-15

Name

MO2-amot

Previous Names

None

Target

amot (1)

Sequence

5' - CCTTACTTGACCTATTGAGGAGCAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-amot

No data available

Phenotype

Phenotype resulting from MO2-amot

Phenotype	Fish	Figures
angiogenesis disrupted, abnormal	zf528Tg + MO2-amot	Fig. 5 from Garnaas et al., 2008
blood vessel endothelial cell migration disrupted, abnormal	y1Tg + MO2-amot	Fig. 1 from Aase et al., 2007
blood vessel morphogenesis disrupted, abnormal	zf528Tg + MO2-amot	Fig. 5 from Garnaas et al., 2008
cell migration involved in sprouting angiogenesis arrested, abnormal	y1Tg + MO2-amot	Fig. 1 from Aase et al., 2007
dorsal longitudinal anastomotic vessel aplastic, abnormal	y1Tg + MO2-amot	Fig. 1 from Aase et al., 2007
endothelial tip cell filopodium decreased amount, abnormal	y1Tg + MO2-amot	Fig. 1 from Aase et al., 2007
intersegmental vessel truncated, abnormal	y1Tg + MO2-amot	Fig. 5 from Garnaas et al., 2008 Fig. 1, text only from Aase et al., 2007
primordial hindbrain channel dilated, abnormal	y1Tg + MO2-amot	Fig. 1 from Aase et al., 2007
primordial midbrain channel dilated, abnormal	y1Tg + MO2-amot	Fig. 1 from Aase et al., 2007

Phenotype of all Fish created by or utilizing MO2-amot

Phenotype	Fish	Conditions	Figures
primordial hindbrain channel dilated, abnormal	y1Tg + MO2-amot	standard conditions	Fig. 1 from Aase et al., 2007
endothelial tip cell filopodium decreased amount, abnormal	y1Tg + MO2-amot	standard conditions	Fig. 1 from Aase et al., 2007
primordial midbrain channel dilated, abnormal	y1Tg + MO2-amot	standard conditions	Fig. 1 from Aase et al., 2007
dorsal longitudinal anastomotic vessel aplastic, abnormal	y1Tg + MO2-amot	standard conditions	Fig. 1 from Aase et al., 2007
intersegmental vessel truncated, abnormal	y1Tg + MO2-amot	standard conditions	Fig. 1, text only from Aase et al., 2007
cell migration involved in sprouting angiogenesis arrested, abnormal	y1Tg + MO2-amot	standard conditions	Fig. 1 from Aase et al., 2007
blood vessel endothelial cell migration disrupted, abnormal	y1Tg + MO2-amot	standard conditions	Fig. 1 from Aase et al., 2007
angiogenesis disrupted, abnormal	zf528Tg + MO2-amot	standard conditions	Fig. 5 from Garnaas et al., 2008
blood vessel morphogenesis disrupted, abnormal	zf528Tg + MO2-amot	standard conditions	Fig. 5 from Garnaas et al., 2008
intersegmental vessel truncated, abnormal	zf528Tg + MO2-amot	standard conditions	Fig. 5 from Garnaas et al., 2008
endothelial tip cell circular, abnormal	zf528Tg + MO1-plekhg5a + MO2-amot	standard conditions	Fig. 5 from Garnaas et al., 2008
intersegmental vessel truncated, abnormal	zf528Tg + MO1-plekhg5a + MO2-amot	standard conditions	Fig. 5 from Garnaas et al., 2008
blood vessel morphogenesis disrupted, abnormal	zf528Tg + MO1-plekhg5a + MO2-amot	standard conditions	Fig. 5 from Garnaas et al., 2008
endothelial tip cell filopodium absent, abnormal	zf528Tg + MO1-plekhg5a + MO2-amot	standard conditions	Fig. 5 from Garnaas et al., 2008
angiogenesis disrupted, abnormal	zf528Tg + MO1-plekhg5a + MO2-amot	standard conditions	Fig. 5 from Garnaas et al., 2008

Citations