Morpholino

MO1-amot

ID
ZDB-MRPHLNO-070906-14
Name
MO1-amot
Previous Names
None
Target
Sequence
5' - CCACTGACACAACTACCACCAAGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-amot
No data available
Phenotype
Phenotype resulting from MO1-amot
Phenotype of all Fish created by or utilizing MO1-amot
Phenotype Fish Conditions Figures
cell migration involved in sprouting angiogenesis arrested, abnormal y1Tg + MO1-amot standard conditions Fig. 1 from Aase et al., 2007
intersegmental vessel morphology, abnormal y1Tg + MO1-amot standard conditions Fig. 7 from Ernkvist et al., 2009
intersegmental vessel decreased length, abnormal y1Tg + MO1-amot standard conditions Fig. 6 from Zheng et al., 2009
angiogenesis disrupted, abnormal y1Tg + MO1-amot standard conditions Fig. 7 from Ernkvist et al., 2009
primordial hindbrain channel dilated, abnormal y1Tg + MO1-amot standard conditions Fig. 1 from Aase et al., 2007
blood vessel endothelial cell migration disrupted, abnormal y1Tg + MO1-amot standard conditions Fig. 1 from Ernkvist et al., 2009
Fig. 1 from Aase et al., 2007
intersegmental vessel truncated, abnormal y1Tg + MO1-amot standard conditions Fig. 1Fig. 6 from Ernkvist et al., 2009
Fig. 1text only from Aase et al., 2007
intersegmental vessel endothelial tip cell positional polarity, abnormal y1Tg + MO1-amot standard conditions Fig. 6 from Zheng et al., 2009
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-amot standard conditions Fig. 1 from Aase et al., 2007
endothelial tip cell filopodium decreased amount, abnormal y1Tg + MO1-amot standard conditions Fig. 1 from Aase et al., 2007
primordial midbrain channel dilated, abnormal y1Tg + MO1-amot standard conditions Fig. 1 from Aase et al., 2007
eye decreased size, abnormal axin1tm213/+ + MO1-amot + MO1-amotl1 + MO1-amotl2a(TU) standard conditions Fig. 2 from Li et al., 2012
eye agenesis, abnormal axin1tm213/tm213 + MO1-amot + MO1-amotl1 + MO1-amotl2a(TU) standard conditions Fig. 2 from Li et al., 2012
intersegmental vessel decreased length, abnormal y1Tg + MO1-amot + MO1-amotl1 standard conditions Fig. 6 from Zheng et al., 2009
intersegmental vessel endothelial tip cell positional polarity, abnormal y1Tg + MO1-amot + MO1-amotl1 standard conditions Fig. 6 from Zheng et al., 2009
intersegmental vessel blood vessel endothelial cell cellular adhesivity intersegmental vessel blood vessel endothelial cell, abnormal y1Tg + MO1-amot + MO1-amotl1 standard conditions Fig. 6 from Zheng et al., 2009
cell-cell adhesion disrupted, abnormal y1Tg + MO1-amot + MO1-amotl1 standard conditions Fig. 6 from Zheng et al., 2009
intersegmental vessel morphology, abnormal y1Tg + MO1-amot + MO1-plekhg5b standard conditions Fig. 7 from Ernkvist et al., 2009
angiogenesis disrupted, abnormal y1Tg + MO1-amot + MO1-plekhg5b standard conditions Fig. 7 from Ernkvist et al., 2009
Citations