Morpholino
MO1-rac1a
- ID
- ZDB-MRPHLNO-070831-3
- Name
- MO1-rac1a
- Previous Names
-
- MO1-rac1
- Target
- Sequence
-
5' - CCACACACTTTATGGCCTGCATCTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rac1a
No data available
Phenotype
Phenotype resulting from MO1-rac1a
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-rac1a
1 - 5 of 12 Show all
Citations
- Mikdache, A., Fontenas, L., Albadri, S., Revenu, C., Loisel-Duwattez, J., Lesport, E., Degerny, C., Del Bene, F., Tawk, M. (2019) Elmo1 function, linked to Rac1 activity, regulates peripheral neuronal numbers and myelination in zebrafish. Cellular and molecular life sciences : CMLS. 77(1):161-177
- Razaghi, B., Steele, S.L., Prykhozhij, S.V., Stoyek, M.R., Hill, J.A., Cooper, M.D., McDonald, L., Lin, W., Daugaard, M., Crapoulet, N., Chacko, S., Lewis, S., Scott, I.C., Sorensen, P.H.B., Berman, J.N. (2017) hace1 influences zebrafish cardiac development via ROS-dependent mechanisms. Developmental Dynamics : an official publication of the American Association of Anatomists. 247(2):289-303
- Epting, D., Slanchev, K., Boehlke, C., Hoff, S., Loges, N.T., Yasunaga, T., Indorf, L., Nestel, S., Lienkamp, S.S., Omran, H., Kuehn, E.W., Ronneberger, O., Walz, G., Kramer-Zucker, A. (2015) The Rac1 regulator ELMO controls basal body migration and docking in multiciliated cells through interaction with Ezrin. Development (Cambridge, England). 142:174-84
- Srinivas, B.P., Woo, J., Leong, W.Y., and Roy, S. (2007) A conserved molecular pathway mediates myoblast fusion in insects and vertebrates. Nature Genetics. 39(6):781-786
1 - 4 of 4
Show