Morpholino

MO1-ednrab

ID
ZDB-MRPHLNO-070829-1
Name
MO1-ednrab
Previous Names
  • ednra1 MO (1)
  • MO1-ednra
  • MO1-ednraa
Target
Sequence
5' - AGTGGTGTGTTCACCTGTTTGAGGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targets sixth transmembrane domain; splice blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ednrab
Phenotype
Phenotype resulting from MO1-ednrab
Phenotype of all Fish created by or utilizing MO1-ednrab
Phenotype Fish Conditions Figures
interhyal cartilage aplastic, abnormal WT + MO1-ednrab standard conditions Fig. 3 with image from Nair et al., 2007
Meckel's cartilage ventral region fused with palatoquadrate cartilage dorsal region, abnormal WT + MO1-ednrab standard conditions Fig. 3 with image from Nair et al., 2007
ventral mandibular arch decreased length, abnormal WT + MO1-ednrab standard conditions Fig. 3 with image from Nair et al., 2007
pharyngeal arch 1 decreased length, abnormal WT + MO1-ednrab standard conditions Fig. 4 with image from Hisano et al., 2013
hyosymplectic cartilage dorsal region fused with ceratohyal cartilage ventral region, abnormal WT + MO1-ednrab standard conditions Fig. 3 with image from Nair et al., 2007
Meckel's cartilage fused with ceratohyal cartilage, abnormal WT + MO1-ednrab standard conditions Fig. 3 with image from Nair et al., 2007
pharyngeal arch 1 decreased length, abnormal fn1akt259/kt259 + MO1-ednrab standard conditions Fig. 4 with image from Hisano et al., 2013
ventral mandibular arch disorganized, abnormal fn1akt259/kt259 + MO1-ednrab standard conditions Fig. 4 with image from Hisano et al., 2013
Meckel's cartilage decreased length, abnormal WT + MO1-ednrab + MO2-ednraa standard conditions Fig. 5Fig. S8 from Gordon et al., 2015
ceratohyal cartilage hypoplastic, abnormal WT + MO1-ednrab + MO2-ednraa standard conditions Fig. S8 from Gordon et al., 2015
mandibular arch skeleton cartilage development disrupted, abnormal WT + MO1-ednrab + MO2-ednraa standard conditions Fig. 5Fig. S8 from Gordon et al., 2015
ceratohyal cartilage aplastic, abnormal WT + MO1-ednrab + MO2-ednraa standard conditions Fig. 3 with image from Nair et al., 2007
Meckel's cartilage absent, abnormal WT + MO1-ednrab + MO2-ednraa standard conditions Fig. 5 from Gordon et al., 2015
ventral mandibular arch aplastic, abnormal WT + MO1-ednrab + MO2-ednraa standard conditions Fig. 3 with image from Nair et al., 2007
Meckel's cartilage decreased size, abnormal WT + MO1-ednrab + MO2-ednraa standard conditions Fig. 3 with image from Nair et al., 2007
heart tube mislocalised laterally, abnormal fn1akt259/kt259; ko07Tg + MO1-ednrab standard conditions Fig. 4 with image from Hisano et al., 2013
heart tube increased amount, abnormal fn1akt259/kt259; ko07Tg + MO1-ednrab standard conditions Fig. 4 with image from Hisano et al., 2013
Citations