Morpholino

MO1-birc5a

ID
ZDB-MRPHLNO-070725-1
Name
MO1-birc5a
Previous Names
  • SurATG (1)
Target
Sequence
5' - TGCAAGATCCATTTTGTGGGAGGTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-birc5a
Expressed Gene Anatomy Figures
bmp4 Fig. 5 with image from Delvaeye et al., 2009
ccnd1 Fig. 9 from Ko et al., 2011
cdkn1bb Fig. 9 from Ko et al., 2011
cdkn1ca Fig. 9 from Ko et al., 2011
crestin Fig. 3 with image from Delvaeye et al., 2009
elavl3 Fig. 6 from Ko et al., 2011
flt4 Fig. 3 with image from Delvaeye et al., 2009
foxd3 Fig. 5 with image from Delvaeye et al., 2009
gata1a Fig. 4 with image from Delvaeye et al., 2009
hey2 Fig. 3 with image from Delvaeye et al., 2009
isl1a Fig. 2 with image from Delvaeye et al., 2009
myh7 Fig. 5 with image from Delvaeye et al., 2009
myl7 Fig. 5 with image from Delvaeye et al., 2009
nes Fig. 9 from Ko et al., 2011
pcna Fig. 9 from Ko et al., 2011
zic1 Fig. 2 with image from Delvaeye et al., 2009
Phenotype
Phenotype resulting from MO1-birc5a
Phenotype Fish Figures
aortic arch hypoplastic, abnormal la116Tg + MO1-birc5a Fig. 3 with image from Delvaeye et al., 2009
atrioventricular valve amorphous, abnormal WT + MO1-birc5a Fig. 5 with image from Delvaeye et al., 2009
axial vasculature decreased diameter, abnormal y1Tg + MO1-birc5a Fig. 3 with image from Delvaeye et al., 2009
blood vessel development delayed, abnormal y1Tg + MO1-birc5a Fig. 3 with image from Delvaeye et al., 2009
brain apoptotic, abnormal WT + MO1-birc5a Fig. 6 with image from Delvaeye et al., 2009
brain decreased size, abnormal WT + MO1-birc5a Fig. 2 with image from Delvaeye et al., 2009
caudal vein plexus apoptotic, abnormal WT + MO1-birc5a Fig. 6 with image from Delvaeye et al., 2009
caudal vein plexus morphology, abnormal y1Tg + MO1-birc5a Fig. 3 with image,  Fig. 8 with image from Delvaeye et al., 2009
caudal vein plexus proliferative region decreased functionality, abnormal WT + MO1-birc5a Fig. 7 with image from Delvaeye et al., 2009
cell population proliferation decreased occurrence, abnormal WT + MO1-birc5a Fig. 7 with image from Delvaeye et al., 2009
dorsal longitudinal anastomotic vessel morphology, abnormal y1Tg + MO1-birc5a Fig. 3 with image,  Fig. 8 with image from Delvaeye et al., 2009
endocardial ring amorphous, abnormal WT + MO1-birc5a Fig. 5 with image from Delvaeye et al., 2009
erythrocyte differentiation disrupted, abnormal WT + MO1-birc5a Fig. 4 with image from Delvaeye et al., 2009
eye decreased size, abnormal WT + MO1-birc5a Fig. 2 with image from Ma et al., 2007
G1 to G0 transition disrupted, abnormal WT + MO1-birc5a Fig. 9 from Ko et al., 2011
head decreased size, abnormal WT + MO1-birc5a Fig. 6,  Fig. 9 from Ko et al., 2011
Fig. 2 with image from Ma et al., 2007
head motor neuron disorganized, abnormal WT + MO1-birc5a Fig. 2 with image from Delvaeye et al., 2009
heart decreased size, abnormal WT + MO1-birc5a Fig. 5 with image from Delvaeye et al., 2009
heart morphology, abnormal WT + MO1-birc5a Fig. 2 with image from Delvaeye et al., 2009
hemopoiesis decreased occurrence, abnormal WT + MO1-birc5a Fig. 7 with image from Delvaeye et al., 2009
intersegmental vessel morphology, abnormal y1Tg + MO1-birc5a Fig. 3 with image,  Fig. 8 with image from Delvaeye et al., 2009
lateral plate mesoderm angioblastic mesenchymal cell cellular motility, abnormal y1Tg + MO1-birc5a Fig. 3 with image from Delvaeye et al., 2009
neural tube proliferative region decreased functionality, abnormal WT + MO1-birc5a Fig. 7 with image from Delvaeye et al., 2009
neuron apoptotic process increased occurrence, abnormal WT + MO1-birc5a Fig. 6 from Ko et al., 2011
neuron differentiation disrupted, abnormal WT + MO1-birc5a Fig. 6,  Fig. 9 from Ko et al., 2011
nucleate erythrocyte decreased amount, abnormal WT + MO1-birc5a Fig. 4 with image from Delvaeye et al., 2009
pericardium edematous, abnormal WT + MO1-birc5a Fig. 2 with image from Delvaeye et al., 2009
pharyngeal arch 3-7 neural crest cell decreased amount, abnormal la116Tg + MO1-birc5a Fig. 3 with image from Delvaeye et al., 2009
post-vent region curved, abnormal WT + MO1-birc5a Fig. 2 with image from Ma et al., 2007
posterior neural tube apoptotic, abnormal WT + MO1-birc5a Fig. 6 with image from Delvaeye et al., 2009
ventricular myocardium decreased thickness, abnormal WT + MO1-birc5a Fig. 5 with image from Delvaeye et al., 2009
Phenotype of all Fish created by or utilizing MO1-birc5a
Phenotype Fish Conditions Figures
ventricular myocardium decreased thickness, abnormal WT + MO1-birc5a standard conditions Fig. 5 with image from Delvaeye et al., 2009
nucleate erythrocyte decreased amount, abnormal WT + MO1-birc5a standard conditions Fig. 4 with image from Delvaeye et al., 2009
caudal vein plexus apoptotic, abnormal WT + MO1-birc5a standard conditions Fig. 6 with image from Delvaeye et al., 2009
atrioventricular valve amorphous, abnormal WT + MO1-birc5a standard conditions Fig. 5 with image from Delvaeye et al., 2009
heart morphology, abnormal WT + MO1-birc5a standard conditions Fig. 2 with image from Delvaeye et al., 2009
erythrocyte differentiation disrupted, abnormal WT + MO1-birc5a standard conditions Fig. 4 with image from Delvaeye et al., 2009
brain decreased size, abnormal WT + MO1-birc5a standard conditions Fig. 2 with image from Delvaeye et al., 2009
brain apoptotic, abnormal WT + MO1-birc5a standard conditions Fig. 6 with image from Delvaeye et al., 2009
head motor neuron disorganized, abnormal WT + MO1-birc5a standard conditions Fig. 2 with image from Delvaeye et al., 2009
neuron apoptotic process increased occurrence, abnormal WT + MO1-birc5a standard conditions Fig. 6 from Ko et al., 2011
heart decreased size, abnormal WT + MO1-birc5a standard conditions Fig. 5 with image from Delvaeye et al., 2009
posterior neural tube apoptotic, abnormal WT + MO1-birc5a standard conditions Fig. 6 with image from Delvaeye et al., 2009
hemopoiesis decreased occurrence, abnormal WT + MO1-birc5a standard conditions Fig. 7 with image from Delvaeye et al., 2009
post-vent region curved, abnormal WT + MO1-birc5a standard conditions Fig. 2 with image from Ma et al., 2007
pericardium edematous, abnormal WT + MO1-birc5a standard conditions Fig. 2 with image from Delvaeye et al., 2009
endocardial ring amorphous, abnormal WT + MO1-birc5a standard conditions Fig. 5 with image from Delvaeye et al., 2009
neural tube proliferative region decreased functionality, abnormal WT + MO1-birc5a standard conditions Fig. 7 with image from Delvaeye et al., 2009
G1 to G0 transition disrupted, abnormal WT + MO1-birc5a standard conditions Fig. 9 from Ko et al., 2011
head decreased size, abnormal WT + MO1-birc5a standard conditions Fig. 6,  Fig. 9 from Ko et al., 2011
Fig. 2 with image from Ma et al., 2007
neuron differentiation disrupted, abnormal WT + MO1-birc5a standard conditions Fig. 6,  Fig. 9 from Ko et al., 2011
cell population proliferation decreased occurrence, abnormal WT + MO1-birc5a standard conditions Fig. 7 with image from Delvaeye et al., 2009
eye decreased size, abnormal WT + MO1-birc5a standard conditions Fig. 2 with image from Ma et al., 2007
caudal vein plexus proliferative region decreased functionality, abnormal WT + MO1-birc5a standard conditions Fig. 7 with image from Delvaeye et al., 2009
axial vasculature apoptotic, abnormal WT + MO1-birc5a + MO2-birc5a standard conditions text only from Ma et al., 2007
brain apoptotic, abnormal WT + MO1-birc5a + MO2-birc5a standard conditions text only from Ma et al., 2007
eye decreased size, abnormal WT + MO1-birc5a + MO2-birc5a standard conditions Fig. 2 with image from Ma et al., 2007
neural tube apoptotic, abnormal WT + MO1-birc5a + MO2-birc5a standard conditions text only from Ma et al., 2007
post-vent region curved, abnormal WT + MO1-birc5a + MO2-birc5a standard conditions Fig. 2 with image from Ma et al., 2007
head decreased size, abnormal WT + MO1-birc5a + MO2-birc5a standard conditions Fig. 2 with image from Ma et al., 2007
pharyngeal arch 3-7 neural crest cell decreased amount, abnormal la116Tg + MO1-birc5a standard conditions Fig. 3 with image from Delvaeye et al., 2009
aortic arch hypoplastic, abnormal la116Tg + MO1-birc5a standard conditions Fig. 3 with image from Delvaeye et al., 2009
intersegmental vessel morphology, abnormal y1Tg + MO1-birc5a standard conditions Fig. 3 with image,  Fig. 8 with image from Delvaeye et al., 2009
caudal vein plexus morphology, abnormal y1Tg + MO1-birc5a standard conditions Fig. 3 with image,  Fig. 8 with image from Delvaeye et al., 2009
dorsal longitudinal anastomotic vessel morphology, abnormal y1Tg + MO1-birc5a standard conditions Fig. 3 with image,  Fig. 8 with image from Delvaeye et al., 2009
blood vessel development delayed, abnormal y1Tg + MO1-birc5a standard conditions Fig. 3 with image from Delvaeye et al., 2009
axial vasculature decreased diameter, abnormal y1Tg + MO1-birc5a standard conditions Fig. 3 with image from Delvaeye et al., 2009
lateral plate mesoderm angioblastic mesenchymal cell cellular motility, abnormal y1Tg + MO1-birc5a standard conditions Fig. 3 with image from Delvaeye et al., 2009
intersegmental vessel morphology, abnormal y1Tg + MO1-birc5a + MO2-birc5a standard conditions Fig. 3 with image from Ma et al., 2007
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-birc5a + MO2-birc5a standard conditions Fig. 3 with image from Ma et al., 2007
blood vessel development disrupted, abnormal y1Tg + MO1-birc5a + MO2-birc5a standard conditions Fig. 3 with image from Ma et al., 2007
optic vein morphology, abnormal y1Tg + MO1-birc5a + MO2-birc5a standard conditions Fig. 3 with image from Ma et al., 2007
subintestinal vein aplastic, abnormal y1Tg + MO1-birc5a + MO2-birc5a standard conditions Fig. 3 with image from Ma et al., 2007
inner optic circle morphology, abnormal y1Tg + MO1-birc5a + MO2-birc5a standard conditions Fig. 3 with image from Ma et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.