Morpholino
MO1-suv39h1a
- ID
- ZDB-MRPHLNO-070615-5
- Name
- MO1-suv39h1a
- Previous Names
-
- MO1-suv39h1
- Target
- Sequence
-
5' - TAATAATCTGACCTTGTGTTTTTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking morpholino directed against the exon 2/intron 2 boundary.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-suv39h1a
No data available
Phenotype
Phenotype resulting from MO1-suv39h1a
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-suv39h1a
1 - 5 of 7 Show all
Citations
- Huang, H.T., Kathrein, K.L., Barton, A., Gitlin, Z., Huang, Y.H., Ward, T.P., Hofmann, O., Dibiase, A., Song, A., Tyekucheva, S., Hide, W., Zhou, Y., and Zon, L.I. (2013) A network of epigenetic regulators guides developmental haematopoiesis in vivo. Nature cell biology. 15(12):1516-1525
- Rai, K., Jafri, I.F., Chidester, S., James, S.R., Karpf, A.R., Cairns, B.R., and Jones, D.A. (2010) Dnmt3 and G9a cooperate for tissue-specific development in zebrafish. The Journal of biological chemistry. 285(6):4110-4121
- Rai, K., Nadauld, L.D., Chidester, S., Manos, E.J., James, S.R., Karpf, A.R., Cairns, B.R., and Jones, D.A. (2006) Zebra fish Dnmt1 and Suv39h1 regulate organ-specific terminal differentiation during development. Molecular and cellular biology. 26(19):7077-7085
1 - 3 of 3
Show