Morpholino

MO1-suv39h1a

ID
ZDB-MRPHLNO-070615-5
Name
MO1-suv39h1a
Previous Names
  • MO1-suv39h1
Target
Sequence
5' - TAATAATCTGACCTTGTGTTTTTTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking morpholino directed against the exon 2/intron 2 boundary.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-suv39h1a
Expressed Gene Anatomy Figures
ascl1b Fig. 6 with image from Rai et al., 2010
crx Fig. 6 with image from Rai et al., 2010
fabp2 Fig. 6 with image from Rai et al., 2010
Fig. 6 from Rai et al., 2006
fabp10a Fig. 6 from Rai et al., 2006
foxa3 text only from Rai et al., 2006
gata6 text only from Rai et al., 2006
hnf1ba text only from Rai et al., 2006
ins Fig. 6 from Rai et al., 2006
neurod1 Fig. 6 with image from Rai et al., 2010
rbp3 Fig. 6 with image from Rai et al., 2010
Fig. 6 from Rai et al., 2006
trp Fig. 6 from Rai et al., 2006
Phenotype
Phenotype resulting from MO1-suv39h1a
Phenotype Fish Figures
exocrine pancreas undifferentiated, abnormal WT + MO1-suv39h1a Fig. 6 from Rai et al., 2006
exocrine pancreas development disrupted, abnormal WT + MO1-suv39h1a Fig. 6 from Rai et al., 2006
histone H3K9 monomethyltransferase activity disrupted, abnormal WT + MO1-suv39h1a Fig. 4 from Rai et al., 2006
pericardium edematous, abnormal WT + MO1-suv39h1a Fig. 6 from Rai et al., 2006
post-vent region curved ventral, abnormal WT + MO1-suv39h1a Fig. 6 from Rai et al., 2006
retina development in camera-type eye disrupted, abnormal WT + MO1-suv39h1a Fig. 6 from Rai et al., 2006
retinal pigmented epithelium dorsal region aplastic, abnormal WT + MO1-suv39h1a Fig. 6 from Rai et al., 2006
Phenotype of all Fish created by or utilizing MO1-suv39h1a
Phenotype Fish Conditions Figures
histone H3K9 monomethyltransferase activity disrupted, abnormal WT + MO1-suv39h1a standard conditions Fig. 4 from Rai et al., 2006
exocrine pancreas development disrupted, abnormal WT + MO1-suv39h1a standard conditions Fig. 6 from Rai et al., 2006
retina development in camera-type eye disrupted, abnormal WT + MO1-suv39h1a standard conditions Fig. 6 from Rai et al., 2006
exocrine pancreas undifferentiated, abnormal WT + MO1-suv39h1a standard conditions Fig. 6 from Rai et al., 2006
pericardium edematous, abnormal WT + MO1-suv39h1a standard conditions Fig. 6 from Rai et al., 2006
post-vent region curved ventral, abnormal WT + MO1-suv39h1a standard conditions Fig. 6 from Rai et al., 2006
retinal pigmented epithelium dorsal region aplastic, abnormal WT + MO1-suv39h1a standard conditions Fig. 6 from Rai et al., 2006
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.