Morpholino
MO3-lama2
- ID
- ZDB-MRPHLNO-070608-2
- Name
- MO3-lama2
- Previous Names
-
- MO-Lama2-60 (1)
- Target
- Sequence
-
5' - TCTCGAACTCAATGACCAACCTGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-lama2
No data available
Phenotype
Phenotype resulting from MO3-lama2
| Phenotype | Fish | Figures |
|---|---|---|
| muscle organ development disrupted, abnormal | WT + MO3-lama2 |
Fig. 3 |
| myotome structure, abnormal | WT + MO3-lama2 |
Fig. 3 |
Phenotype of all Fish created by or utilizing MO3-lama2
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| muscle organ development disrupted, abnormal | WT + MO3-lama2 | standard conditions |
Fig. 3 |
| myotome structure, abnormal | WT + MO3-lama2 | standard conditions |
Fig. 3 |
Citations