Morpholino
MO3-dkk1b
- ID
- ZDB-MRPHLNO-070604-2
- Name
- MO3-dkk1b
- Previous Names
-
- MO3-dkk1
- Target
- Sequence
-
5' - TAGAGAGCATGGCGATGTGCATCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-dkk1b
No data available
Phenotype
Phenotype resulting from MO3-dkk1b
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO3-dkk1b
1 - 5 of 8 Show all
Citations
- Johansson, M., Giger, F.A., Fielding, T., Houart, C. (2019) Dkk1 Controls Cell-Cell Interaction through Regulation of Non-nuclear β-Catenin Pools. Developmental Cell. 51(6):775-786.e3
- Tanaka, S., Hosokawa, H., Weinberg, E.S., Maegawa, S. (2017) Chordin and dickkopf-1b are essential for the formation of head structures through activation of the FGF signaling pathway in zebrafish. Developmental Biology. 424(2):189-197
- Caneparo, L., Huang, Y.L., Staudt, N., Tada, M., Ahrendt, R., Kazanskaya, O., Niehrs, C., and Houart, C. (2007) Dickkopf-1 regulates gastrulation movements by coordinated modulation of Wnt/betacatenin and Wnt/PCP activities, through interaction with the Dally-like homolog Knypek. Genes & Development. 21(4):465-480
- Houart, C., Caneparo, L., Heisenberg, C.P., Barth, K.A., Take-uchi, M., and Wilson, S.W. (2002) Establishment of the telencephalon during gastrulation by local antagonism of Wnt signaling. Neuron. 35(2):255-265
1 - 4 of 4
Show