Morpholino
MO2-dkk1b
- ID
- ZDB-MRPHLNO-070604-1
- Name
- MO2-dkk1b
- Previous Names
-
- MO2-dkk1
- Target
- Sequence
-
5' - AATTGTAGGATGTATTCCCTGGGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dkk1b
No data available
Phenotype
Phenotype resulting from MO2-dkk1b
Phenotype | Fish | Figures |
---|---|---|
eye decreased size, abnormal | WT + MO2-dkk1b |
text only
from Caneparo et al., 2007 |
telencephalon decreased size, abnormal | WT + MO2-dkk1b |
text only
from Caneparo et al., 2007 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO2-dkk1b
1 - 5 of 11 Show all
Citations
- Bielen, H., and Houart, C. (2012) BMP Signaling Protects Telencephalic Fate by Repressing Eye Identity and Its Cxcr4-Dependent Morphogenesis. Developmental Cell. 23(4):812-822
- Kagermeier-Schenk, B., Wehner, D., Ozhan-Kizil, G., Yamamoto, H., Li, J., Kirchner, K., Hoffmann, C., Stern, P., Kikuchi, A., Schambony, A., and Weidinger, G. (2011) Waif1/5T4 Inhibits Wnt/β-Catenin Signaling and Activates Noncanonical Wnt Pathways by Modifying LRP6 Subcellular Localization. Developmental Cell. 21(6):1129-43
- Wang, W.D., Melville, D.B., Montero-Balaguer, M., Hatzopoulos, A.K., and Knapik, E.W. (2011) Tfap2a and Foxd3 regulate early steps in the development of the neural crest progenitor population. Developmental Biology. 360(1):173-85
- Caneparo, L., Huang, Y.L., Staudt, N., Tada, M., Ahrendt, R., Kazanskaya, O., Niehrs, C., and Houart, C. (2007) Dickkopf-1 regulates gastrulation movements by coordinated modulation of Wnt/betacatenin and Wnt/PCP activities, through interaction with the Dally-like homolog Knypek. Genes & Development. 21(4):465-480
1 - 4 of 4
Show