Morpholino

MO3-otpb

ID

ZDB-MRPHLNO-070531-5

Name

MO3-otpb

Previous Names

None

Target

otpb (1)

Sequence

5' - GAGCAAGTTCATTAAGTCTCACCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-site-specific MO targeted to the second exon–intron boundary of the otpb gene.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-otpb

Expressed Gene	Anatomy	Figures
fezf2	hypothalamus posterior region preoptic area	Fig. 1 from Wolf et al., 2013
foxb1a	hypothalamus posterior region	Fig. 1 from Wolf et al., 2013
otpa	diencephalon	Fig. 2 from Ryu et al., 2007
sim1a	caudal tuberculum hypothalamus midbrain preoptic area	Fig. 5 from Löhr et al., 2009
sim1b	caudal tuberculum hypothalamus midbrain preoptic area	Fig. 5 from Löhr et al., 2009
th	anterior catecholaminergic tract diencephalon dopaminergic neuron hypothalamus locus coeruleus adrenergic neuron medial longitudinal catecholaminergic tract medulla oblongata adrenergic neuron olfactory bulb dopaminergic neuron preoptic area dopaminergic neuron ventral telencephalon dopaminergic neuron	Fig. 4, Fig. 6, Fig. 7, Fig. 8 from Kastenhuber et al., 2010 Fig. 2, Fig. S6 from Ryu et al., 2007
uts1	hypothalamus posterior region	Fig. 7 from Wolf et al., 2013
vip	hypothalamus posterior region	Fig. 7 from Wolf et al., 2013

Phenotype

Phenotype resulting from MO3-otpb

Phenotype	Fish	Figures
amacrine cell decreased amount, abnormal	WT + MO3-otpb	Fig. S6 from Ryu et al., 2007
brain decreased size, abnormal	WT + MO3-otpb	Fig. S6 from Ryu et al., 2007
dopaminergic neuron disorganized, abnormal	WT + MO3-otpb	Fig. S6 from Ryu et al., 2007

Phenotype of all Fish created by or utilizing MO3-otpb

Phenotype	Fish	Conditions	Figures
brain decreased size, abnormal	WT + MO3-otpb	standard conditions	Fig. S6 from Ryu et al., 2007
amacrine cell decreased amount, abnormal	WT + MO3-otpb	standard conditions	Fig. S6 from Ryu et al., 2007
dopaminergic neuron disorganized, abnormal	WT + MO3-otpb	standard conditions	Fig. S6 from Ryu et al., 2007
caudal tuberculum dopaminergic neuron decreased amount, abnormal	otpa^m866/m866 + MO3-otpb (AB)	standard conditions	Fig. 2 from Ryu et al., 2007
hypothalamus dopaminergic neuron decreased amount, abnormal	otpa^m866/m866 + MO3-otpb (AB)	standard conditions	Fig. 2 from Ryu et al., 2007
postoptic commissure decreased size, abnormal	otpa^m866/m866 + MO3-otpb (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
hypothalamus dopaminergic neuron decreased amount, abnormal	otpa^m866/m866 + MO3-otpb (AB/TL)	standard conditions	Fig. 4, Fig. 6 from Kastenhuber et al., 2010
caudal tuberculum dopaminergic neuron absent, abnormal	otpa^m866/m866 + MO3-otpb (AB/TL)	standard conditions	Fig. 4, Fig. 6 from Kastenhuber et al., 2010
medial longitudinal catecholaminergic tract decreased size, abnormal	otpa^m866/m866 + MO3-otpb (AB/TL)	standard conditions	Fig. 6, Fig. 8 from Kastenhuber et al., 2010
medial longitudinal catecholaminergic tract absent, abnormal	otpa^m866/m866 + MO3-otpb (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
preopticohypothalamic tract absent, abnormal	otpa^m866/m866 + MO3-otpb (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
anterior catecholaminergic tract decreased size, abnormal	otpa^m866/m866 + MO3-otpb (AB/TL)	standard conditions	Fig. 4, Fig. 6 from Kastenhuber et al., 2010
medulla oblongata adrenergic neuron absent, abnormal	otpa^m866/+ + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
anterior catecholaminergic tract decreased size, abnormal	otpa^m866/+ + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
locus coeruleus adrenergic neuron absent, abnormal	otpa^m866/+ + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
anterior catecholaminergic tract absent, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4, Fig. 7 from Kastenhuber et al., 2010
preopticohypothalamic tract absent, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
medial longitudinal catecholaminergic tract absent, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4, Fig. 8 from Kastenhuber et al., 2010
diencephalon dopaminergic neuron decreased amount, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
locus coeruleus adrenergic neuron absent, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
medulla oblongata adrenergic neuron absent, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
postoptic commissure decreased size, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010

Citations