Morpholino

MO2-pbx2

ID
ZDB-MRPHLNO-070529-2
Name
MO2-pbx2
Previous Names
  • Pbx2MO2 (1)
Target
Sequence
5' - GCTGCAACATCCTGAGCACTACATT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pbx2
No data available
Phenotype
Phenotype resulting from MO2-pbx2
No data available
Phenotype of all Fish created by or utilizing MO2-pbx2
Phenotype Fish Conditions Figures
margin aldh1a2 expression decreased distribution, abnormal pbx4b557/b557 + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 8 with image from Selland et al., 2018
optic tectum decreased size, abnormal pbx4b557/b557 + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 1 from Erickson et al., 2007
cerebellum malformed, abnormal pbx4b557/b557 + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 1 from Erickson et al., 2007
margin aldh1a2 expression decreased amount, abnormal pbx4b557/b557 + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 8 with image from Selland et al., 2018
midbrain hindbrain boundary malformed, abnormal pbx4b557/b557 + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 1 from Erickson et al., 2007
cell migration to the midline involved in heart development delayed, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 4 with image from Maves et al., 2009
heart tube aplastic, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 4 with image from Maves et al., 2009
pericardium edematous, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 1 with image from Maves et al., 2009
heart contraction decreased rate, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 1 with image from Maves et al., 2009
atrium decreased size, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 4 with image from Maves et al., 2009
hindbrain tshz3b expression decreased amount, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 control Fig. 5 from Erickson et al., 2011
heart morphogenesis process quality, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 4 with image from Maves et al., 2009
margin aldh1a2 expression decreased amount, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 8 with image from Selland et al., 2018
heart decreased functionality, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 1 with image from Maves et al., 2009
heart development disrupted, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 1 with imageFig. 4 with image from Maves et al., 2009
cardiac ventricle shape, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 4 with image from Maves et al., 2009
midbrain tshz3b expression decreased amount, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 control Fig. 5 from Erickson et al., 2011
cardiac ventricle decreased size, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 4 with image from Maves et al., 2009
atrium shape, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 4 with image from Maves et al., 2009
cardiac muscle cell differentiation disrupted, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 4 with image from Maves et al., 2009
heart looping disrupted, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 4 with image from Maves et al., 2009
heart primordium myocardial precursor decreased amount, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 4 with image from Maves et al., 2009
embryonic heart tube elongation disrupted, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 4 with image from Maves et al., 2009
heart morphology, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 1 with imageFig. 5 with image from Maves et al., 2009
cell migration to the midline involved in heart development process quality, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 4 with image from Maves et al., 2009
blood accumulation atrium, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 1 with image from Maves et al., 2009
heart morphogenesis disrupted, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 5 with image from Maves et al., 2009
heart primordium unfused from heart primordium, abnormal AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 4 with image from Maves et al., 2009
skeletal muscle fiber development disrupted, abnormal WIK/AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 1 with imageFig. 2 with imageFig. 3 with image from Maves et al., 2007
heart morphology, abnormal AB + MO1-pbx2 + MO2-hand2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 5 with image from Maves et al., 2009
heart primordium unfused from heart primordium, abnormal AB + MO1-pbx2 + MO2-hand2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 5 with image from Maves et al., 2009
heart morphogenesis disrupted, abnormal AB + MO1-pbx2 + MO2-hand2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 5 with image from Maves et al., 2009
skeletal muscle fiber development disrupted, abnormal WIK/AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 + MO7-myod1 + MO8-myod1 standard conditions Fig. 4 with image from Maves et al., 2007
Citations