Morpholino

MO1-zic5

ID

ZDB-MRPHLNO-070523-1

Name

MO1-zic5

Previous Names

5MOC (1)

Target

zic5 (1)

Sequence

5' - GGCTTCTCACCTGTCAAATGTAAAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

intron 1/exon 2 splice-blocker

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-zic5

No data available

Phenotype

Phenotype resulting from MO1-zic5

Phenotype	Fish	Figures
fourth ventricle malformed, abnormal	WT + MO1-zic5	text only from Nyholm et al., 2007
tectal ventricle malformed, abnormal	WT + MO1-zic5	text only from Nyholm et al., 2007

Phenotype of all Fish created by or utilizing MO1-zic5

Phenotype	Fish	Conditions	Figures
fourth ventricle malformed, abnormal	WT + MO1-zic5	standard conditions	text only from Nyholm et al., 2007
tectal ventricle malformed, abnormal	WT + MO1-zic5	standard conditions	text only from Nyholm et al., 2007
cell proliferation in midbrain disrupted, abnormal	WT + MO1-zic5 + MO3-zic2a	standard conditions	Fig. 9 from Nyholm et al., 2007
actin-myosin filament sliding decreased rate, abnormal	WT + MO1-zic5 + MO3-zic2a	standard conditions	Fig. 3 from Nyholm et al., 2009
secondary neural tube formation process quality, abnormal	WT + MO1-zic5 + MO3-zic2a	standard conditions	Fig. 2 from Nyholm et al., 2009
tectal ventricle malformed, abnormal	WT + MO1-zic5 + MO3-zic2a	standard conditions	Fig. 2 from Nyholm et al., 2009 Fig. 7 , Fig. 8 from Nyholm et al., 2007
regulation of mitotic cell cycle, embryonic process quality, abnormal	WT + MO1-zic5 + MO3-zic2a	standard conditions	Fig. 6 from Nyholm et al., 2009
alar plate midbrain region physical object quality, abnormal	WT + MO1-zic5 + MO3-zic2a	standard conditions	Fig. 3 from Nyholm et al., 2009
alar plate midbrain region apical junction complex patchy, abnormal	WT + MO1-zic5 + MO3-zic2a	standard conditions	Fig. 4 from Nyholm et al., 2009
tectal ventricle decreased size, abnormal	WT + MO1-zic5 + MO3-zic2a	standard conditions	Fig. 2 from Nyholm et al., 2009
midbrain development process quality, abnormal	WT + MO1-zic5 + MO3-zic2a	standard conditions	Fig. 2, Fig. 6 from Nyholm et al., 2009
hindbrain malformed, abnormal	WT + MO1-zic5 + MO3-zic2a	standard conditions	Fig. 7 , Fig. 8 from Nyholm et al., 2007
midbrain malformed, abnormal	WT + MO1-zic5 + MO3-zic2a	standard conditions	Fig. 2, Fig. 6 from Nyholm et al., 2009 Fig. 7 , Fig. 8 from Nyholm et al., 2007

Citations